Yeast

From partsregistry.org

S. cerevisiae, a species of budding yeast, is a convenient chassis for engineered biological systems for several reasons.

It is one of the most intensively studied eukaryotic model organisms in molecular and cell biology.
As a single celled organism S. cerevisiae is small with a short generation time (doubling time 1.5–2 hours at 30°C) and can be easily cultured.
S. cerevisiae can be transformed allowing for either the addition of new genes or deletion through homologous recombination. Furthermore, The ability to grow S. cerevisiae as a haploid simplifies the creation of gene knockouts strains.
As a eukaryote, S. cerevisiae shares the complex internal cell structure of plants and animals without the high percentage of non-coding DNA that can confound research in higher eukaryotes.

As an aside, it is perhaps the most useful yeast owing to its use since ancient times in baking and brewing.

Plasmid backbones (?)

Promoters (?)

Kozak sequences (?)

Protein domains (?)

Protein coding sequences (?)

Translational units (?)

Terminators (?)

Help: Want to know more about Yeast? See the help pages for more information.

Plasmid backbones

Plasmids are circular, double-stranded DNA molecules typically containing a few thousand base pairs that replicate within the cell independently of the chromosomal DNA. Plasmid DNA is easily purified from cells, manipulated using common lab techniques and incorporated into cells. Most BioBrick parts in the Registry are maintained and propagated on plasmids. Thus, construction of BioBrick parts, devices and systems usually requires working with plasmids.

Note: In the Registry, plasmids are made up of two distinct components:

the BioBrick part, device or system that is located in the BioBrick cloning site, between (and excluding) the BioBrick prefix and suffix.
the plasmid backbone which propagates the BioBrick part. The plasmid backbone is defined as the sequence beginning with the BioBrick suffix, including the replication origin and antibiotic resistance marker, and ending with the BioBrick prefix. [Note that the plasmid backbone itself can be composed of BioBrick parts.]

Many BioBrick parts in the Registry are maintained on more than one plasmid backbone!

Note that most of these plasmid backbones comply with the Lim lab AarI part assembly standard. See the 2008 UCSF iGEM team wiki for more details.

*More...*
-?-		Name	Description	Resistance	Length
1	W	BBa_J63010	Protein fusion vector (Silver lab standard)	A	3266
A	W	BBa_K106006	AarI AD acceptor vector (pRS315, Adh1P, Adh1t)		7650
A	W	BBa_K106014	AarI AD acceptor vector (pRS315, Cyc1P, Adh1t)		6397
A	W	BBa_K106670	AarI AD acceptor, pRS315, 8X LexAOPs Cyc1P, Adht1		6559
A	W	BBa_K106672	AarI AD acceptor vector (pRS305, Gal1P, Adh1t)		6638
A	W	BBa_K106693	AarI A!D acceptor vector (pRS315, Cyc1P, Adh1t)		7650
A	W	BBa_K106697	AarI AD acceptor vector (pRS315, Cyc1P, Adh1t-8XLexA Ops)		6559
A	W	BBa_K106698	AarI AD acceptor vector (pRS315, 8X LexAOps Fig1P, Adh1t)		7364
A	W	BBa_K319043	ADE4 targeting vector		2508
		BBa_K394001	Plasmid for Chromosomal Integration in Yeast at His3		3457
		BBa_K394002	Plasmid for Chromosomal Integration in Yeast at Ura3		3458
	W	BBa_K555009	pYES2 - galactose-inducible expression vector for yeast		5856
	W	BBa_K801000	pTUM100 yeast shuttle vector based on pYES2		4923
	W	BBa_K801001	pTUM101 yeast shuttle vector with pTEF1 promoter		5315
	W	BBa_K801002	pTUM102 yeast shuttle vector with pTEF2 promoter		5514
	W	BBa_K801003	pTUM103 yeast shuttle vector with pADH1 promoter		5585
	W	BBa_K801004	pTUM104 yeast shuttle vector with GAL1 promoter		5837

Sergio Peisajovich and Andrew Horowitz, from Wendell Lim's lab, developed several of the yeast plasmid backbones as an instructor of the 2008 UCSF iGEM team.

Promoters

The registry symbol for a promoter is shown above a typical sequence for a bacterial promoter. The lavender shaded boxes indicate the two most conserved regions of a bacterial promoter and are located at -10 and -35 bases from the transcriptional start site (shaded in green). There are, on average, 17bp between the -10 and -35 sites and 7bp between the -10 site and the transcriptional start site pribnowharleylisser1lisser2.

A promoter is a DNA sequence that can recruit transcriptional machinery and lead to transcription of the downstream DNA sequence. The specific sequence of the promoter determines the strength of the promoter (a strong promoter leads to a high rate of transcription initiation).

In addition to sequences that "promote" transcription, a promoter may include additional sequences known as operators that control the strength of the promoter. For example, a promoter may include a binding site for a protein that attracts or obstructs the RNAP binding to the promoter. The presence or absence of the protein will affect the strength of the promoter. Such a promoter is known as a regulated promoter.

Constitutive

All the promoters on this page are yeast promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcriptional regulators. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!

*More...*
-?-		Name	Description	Promoter Sequence
	W	BBa_I766555	pCyc (Medium) Promoter	. . . acaaacacaaatacacacactaaattaata
	W	BBa_I766556	pAdh (Strong) Promoter	. . . ccaagcatacaatcaactatctcatataca
	W	BBa_I766557	pSte5 (Weak) Promoter	. . . gatacaggatacagcggaaacaacttttaa
1	W	BBa_J63005	yeast ADH1 promoter	. . . tttcaagctataccaagcatacaatcaact
1		BBa_K105027	cyc100 minimal promoter	. . . cctttgcagcataaattactatacttctat
1		BBa_K105028	cyc70 minimal promoter	. . . cctttgcagcataaattactatacttctat
1		BBa_K105029	cyc43 minimal promoter	. . . cctttgcagcataaattactatacttctat
1		BBa_K105030	cyc28 minimal promoter	. . . cctttgcagcataaattactatacttctat
1		BBa_K105031	cyc16 minimal promoter	. . . cctttgcagcataaattactatacttctat
A		BBa_K122000	pPGK1	. . . ttatctactttttacaacaaatataaaaca
		BBa_K124000	pCYC Yeast Promoter	. . . acaaacacaaatacacacactaaattaata
	W	BBa_K124002	Yeast GPD (TDH3) Promoter	. . . gtttcgaataaacacacataaacaaacaaa
A	W	BBa_K319005	yeast mid-length ADH1 promoter	. . . ccaagcatacaatcaactatctcatataca
		BBa_M31201	Yeast CLB1 promoter region, G2/M cell cycle specific	. . . accatcaaaggaagctttaatcttctcata

Positively regulated

All the promoters on this page are yeast promoters that are positively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will increase the activity of these promoters.

*More...*
-?-		Name	Description	Promoter Sequence
1	W	BBa_J63006	yeast GAL1 promoter	. . . gaggaaactagacccgccgccaccatggag
U		BBa_K110014	A-Cell Promoter MFA2 (backwards)	. . . atcttcatacaacaataactaccaacctta
U		BBa_K110004	Alpha-Cell Promoter Ste3	. . . gggagccagaacgcttctggtggtgtaaat
		BBa_K753000	Yeast FIG1 promoter	. . . aaacaaacaaacaaaaaaaaaaaaaaaaaa
		BBa_K586000	Cup-1 Heavy metal sensor	. . . accaagaagtcatgctgctctgggaaatga
		BBa_K106699	Gal1 Promoter	. . . aaagtaagaatttttgaaaattcaatataa
		BBa_J24813	URA3 Promoter from S. cerevisiae	. . . gcacagacttagattggtatatatacgcat
A		BBa_K392001	yeast ENO2 promoter	. . . aagcaactaatactataacatacaataata
A		BBa_K284003	Partial DLD Promoter from Kluyveromyces lactis	. . . aagtgcaagaaagaccagaaacgcaactca
A		BBa_K284002	JEN1 Promoter from Kluyveromyces lactis	. . . gagtaaccaaaaccaaaacagatttcaacc
1		BBa_K165041	Zif268-HIV binding sites + TEF constitutive yeast promoter	. . . atacggtcaacgaactataattaactaaac
1		BBa_K165034	Zif268-HIV bs + LexA bs + mCYC promoter	. . . cacaaatacacacactaaattaataactag
A		BBa_K165031	mCYC promoter plus LexA binding sites	. . . cacaaatacacacactaaattaataactag
A		BBa_K165030	mCYC promoter plus Zif268-HIV binding sites	. . . cacaaatacacacactaaattaataactag
1		BBa_K165001	pGAL1+ w/XhoI sites	. . . atactttaacgtcaaggagaaaaaactata
1		BBa_K110016	A-Cell Promoter STE2 (backwards)	. . . accgttaagaaccatatccaagaatcaaaa
1		BBa_K110006	Alpha-Cell Promoter MF(ALPHA)1	. . . tttcatacacaatataaacgattaaaagaa
1		BBa_K110005	Alpha-Cell Promoter MF(ALPHA)2	. . . aaattccagtaaattcacatattggagaaa
U		BBa_K110015	A-Cell Promoter MFA1 (RtL)	. . . cttcatatataaaccgccagaaatgaatta

Repressible

All the promoters on this page are yeast promoters that are negatively regulated meaning that increased levels of at least one transcription factor (other than the sigma factor) will decrease the activity of these promoters.

*More...*
-?-		Name	Description	Promoter Sequence
A	W	BBa_K165000	MET 25 Promoter	. . . tagatacaattctattacccccatccatac
		BBa_I766558	pFig1 (Inducible) Promoter	. . . aaacaaacaaacaaaaaaaaaaaaaaaaaa
		BBa_I766214	pGal1	. . . atactttaacgtcaaggagaaaaaactata
		BBa_K950000	yeast fet3 promotor	. . . cagtgtaaggaagagtagcaaaaaattaga
		BBa_K950002	yeast anb1 promotor	. . . catacacctatttcattcacacactaaaac
		BBa_K950003	yeast suc2 promotor	. . . aaaaagcttttcttttcactaacgtatatg

Multiply regulated

This page lists yeast promoters that are Multi-regulated meaning that each promoter is either positively or negatively regulated by multiple transcription factors (other than the sigma factor). For example, a promoter negatively regulated by two repressor proteins forms the basis of a nor gate, the presence of either or both repressors is sufficient to produce a low output from the promoter. These promoters are useful if, for example, you are looking to build logic gates, or if you are looking to build a system where expression of a gene must be dependent on multiple environmental factors.

*More...*
-?-	Name	Description	Promoter Sequence
	BBa_I766200	pSte2	. . . accgttaagaaccatatccaagaatcaaaa
1	BBa_K110016	A-Cell Promoter STE2 (backwards)	. . . accgttaagaaccatatccaagaatcaaaa
1	BBa_K165034	Zif268-HIV bs + LexA bs + mCYC promoter	. . . cacaaatacacacactaaattaataactag
1	BBa_K165041	Zif268-HIV binding sites + TEF constitutive yeast promoter	. . . atacggtcaacgaactataattaactaaac
1	BBa_K165043	Zif268-HIV binding sites + MET25 constitutive yeast promoter	. . . tagatacaattctattacccccatccatac

Kozak sequences

A sequence logo showing the most conserved bases around the initiation codon from all human mRNAs.

Yeast RBSs, more often known as Kozak sequences, are designed to be recognized by the yeast ribosome. As a eukaryotic translation signal, the sequence of yeast RBSs are distinct from prokaryotic RBSs. The registry collection of yeast RBSs is currently small, we need your help! Please contribute new yeast RBSs to the registry or provide further information about our existing yeast RBSs.

*More...*
-?-		Name	Sequence	Description	Relative Strength
1	W	BBa_J63003	cccgccgccaccatggag	designed yeast Kozak sequence	n/a
A		BBa_K165002	cccgccgccaccatggag	Kozak sequence (yeast RBS)
	W	BBa_K792001	ggatccacgattaaaagaatg	Kozak sequence from yeast α-factor mating pheromone (MFα1)

Protein tags and modifiers

Protein domains encode portions of proteins and can be assembled together to form translational units, a genetic part spanning from translational initiation (the RBS) to translational termination (the stop codon).

There are several different types of protein domains.

Head Domain: The Head domain consists of the start codon followed immediately by zero or more triplets specifiying an N-terminal tag, such as a protein export tag or lipoprotein binding tag. Head domains should begin with an ATG start codon and include codons 2 and 3 of the protein at a minimum. Examples of head domains include
- ATG start codon
- ATG start codon and codons 2-3
- ATG start codon and signal sequence
- ATG start codon and affinity tag
Internal Domains: Protein domains consist of a series of codon triplets coding for an amino acid sequence without a start codon or stop codon. Multiple Internal Domains can be fused. Examples of internal domains include
- DNA binding domains
- Dimerization domains
- Kinase domains
Special Internal Domains: Short Domains with specific function may be separately categorized, but obey the same composition rules as normal internal domains. Examples of special internal domains include
- Linkers
- Cleavage sites
- Inteins
Tail Domain: The C-terminus of a coding region consists of zero or more triplet codons, followed by a pair of TAA stop codons. In the simplest case, the stop codons terminate the protein with an Stop. More complex Tails may include degradation tags appropriate to the organism (i.e., with different degradation rates). Examples of Tail domain include
- TAATAA stop codons
- A degradation tag followed by TAATAA stop codons
- An affinity tag followed by TAATAA stop codon

Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting protein coding sequence or translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.

Protein coding sequences should be as follows

GAATTC GCGGCCGC T TCTAG [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

Note: Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.

*More...*
-?-		Name	Description	Length
A	W	BBa_J63007	PKI nuclear export sequence; yeast codon optimized	30
1	W	BBa_J63008	SV40 nuclear localization sequence from SV40; yeast codon optimized	21
1		BBa_K105013	cin8 - cell cycle specific degradation tag in yeast	228
1		BBa_K105015	hsl1 - cell cycle dependent degradation tag in yeast	618
		BBa_K416000	Aga2 CDS Responsible for Yeast Surface Display	261
A	W	BBa_K416003	Yeast Secretion Tag	114
	W	BBa_K792002	Secretion tag from yeast α-factor mating pheromone (MFα1)	54
		BBa_K801030	Polypeptide containing SV40 nuclear localization sequence (SV40 NLS) for nuclear translocation	57

Protein coding sequences

Protein coding sequences are DNA sequences that are transcribed into mRNA and in which the corresponding mRNA molecules are translated into a polypeptide chain. Every three nucleotides, termed a codon, in a protein coding sequence encodes 1 amino acid in the polypeptide chain. In some cases, different chassis may either map a given codon to a different sequence or may use different codons more or less frequently. Therefore some protein coding sequences may be optimized for use in a particular chassis.

In the Registry, protein coding sequences begin with a start codon (usually ATG) and end with a stop codon (usually with a double stop codon TAA TAA). Protein coding sequences are often abbreviated with the acronym CDS.

Although protein coding sequences are often considered to be basic parts, in fact proteins coding sequences can themselves be composed of one or more regions, called protein domains. Thus, a protein coding sequence could either be entered as a basic part or as a composite part of two or more protein domains.

The N-terminal domain of a protein coding sequence is special in a number of ways. First, it always contains a start codon, spaced at an appropriate distance from a ribosomal binding site. Second, many coding regions have special features at the N terminus, such as protein export tags and lipoprotein cleavage and attachment tags. These occur at the beginning of a coding region, and therefore are termed Head domains.
A protein domain is a sequence of amino acids which fold relatively independently and which are evolutionarily shuffled as a unit among different protein coding regions. The DNA sequence of such domains must maintain in-frame translation, and thus is a multiple of three bases. Since these protein domains are within a protein coding sequence, they are called Internal domains. Certain Internal domains have particular functions in protein cleavage or splicing and are termed Special Internal domains.
Similarly, the C-terminal domain of a protein is special, containing at least a stop codon. Other special features, such as degradation tags, are also required to be at the extreme C-terminus. Again, these domains cannot function when internal to a coding region, and are termed Tail domains.

For more details on protein domains including how to assemble protein domains into protein coding sequences, please see Protein domains.

Protein coding sequences should be as follows

GAATTC GCGGCCGC T TCTAG [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

*More...*
-?-		Name	Protein	Description	Tag	Length
1		BBa_E2050	mOrange	derivative of mRFP1, yeast-optimized	None	769
1	W	BBa_K106001		Sir4, Aar1 AD part		4077
1	W	BBa_K106002		Sir2, Aar1 AB part		1686
1	W	BBa_K106003		Sir2, Aar1 BD part		1686
1	W	BBa_K106011	Sas2	Sas2 histone acetyltransferase, Aar1 AB part		1017
1	W	BBa_K106012	Sas2	Sas2 histone acetyltransferase, Aar1 BD part		1014
1	W	BBa_K106013	Esa1	Esa1 histone acetyltransferase, Aar1 BD part		1338
A		BBa_K165005		Venus YFP, yeast optimized for fusion		744
A	W	BBa_K211002		RI7-odr10 chimeric GPCR	FLAG	1062
		BBa_K284000		Lactate Permease from Kluyveromyces lactis		1873
		BBa_K284997		Deletar este		1069
A	W	BBa_K394000		Resistance Gene for G418 in Yeast		813
		BBa_K394003		Sex-Lethal from Drosophila melanogaster		1062
		BBa_K775000		RI7-GPR109A Niacin chimeric GPCR		1414
		BBa_K775003		RI7-odr10 (diacetyl) chimeric GPCR with promoter and terminator		1444
	W	BBa_K801039		SV40NLS-GAL4AD-linker-PIF3 (part for GAL4/LexA based light-switchable promoter system)		804
	W	BBa_K801040		SV40NLS-PhyB-linker-Gal4DBD (part for GAL4 based light switchable promoter system)		3294
	W	BBa_K801060		(+)-Limonene synthase 1 with Strep-tag and yeast consensus sequence.		1708
	W	BBa_K801061		(+)-Limonene synthase 1 coding region		1665
	W	BBa_K801070		xanthosine methyltransferase CaXMT1-strep		1158
	W	BBa_K801071		7-methylxanthine N-methyltransferase CaMXMT1-strep		1176
	W	BBa_K801072		3,7-dimethylxanthine N-methyltransferase CaDXMT1-strep		1194
	W	BBa_K801080		Prepro-Thaumatin, yeast codon optimized		708
		BBa_K801090		phenylalanine ammonia lyase (PAL) + yeast consensus sequence		2154
		BBa_K801091		phenylalanine ammonia lyase (PAL) coding region		2148
		BBa_K801092		4-coumarate - coenzym A ligase (4CL) + yeast consensus sequence		1692
		BBa_K801093		4-coumarate--coenzyme A ligase (4CL) coding region		1686
		BBa_K801094		Naringenin - chalcone synthase (CHS) + yeast consensus sequence		1176
		BBa_K801095		Naringenin - chalcone synthase (CHS) coding region		1170
		BBa_K801096		Aromatic prenyltransferase (APT) coding region		1233
		BBa_K801097		Chalcone O-methyltransferase (OMT1) + yeast consensus sequence		1062
		BBa_K801098		O-methyltransferase 1 (OMT1) coding region		1056
		BBa_K809401		REX coding sequence		777
		BBa_K950001		yeast rox1		1225
		BBa_K950009		yeast mig1		1515
A		BBa_Y00029		S. pombe homolog of S.cerevisiae SGF29, recoded for expression in S.c.		794
A		BBa_Y00073		S. pombe gene SPCC126.04c, coded for S. cerevisiae expression		1094

Translational units

Translational units begin with the RBS, the site of ribosome binding and translational initiation, and end with a stop codon, the site of translational termination. Every translational unit in the Registry consists of at least three parts, a Translational start, one or more Internal Domains including Special Internal Domains, and a Tail Domain. Thus translational units can, in some sense, be thought of as a composite part made up of three or more parts. Protein coding sequences, in contrast, begin with a start codon and end with a stop codon.

For more information on protein domains, see protein domains. Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.

Translational units should be as follows

GAATTC GCGGCCGC T TCTAGA G [RBS] [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG

Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.

*More...*
-?-	Name	Description	Length
A	BBa_K165057	Kozak + mCherry	761
A	BBa_K165058	Kozak + YFP	770
A	BBa_K165059	Kozak + CFPx2	1520

Terminators

Here are all the yeast terminators available. As you can see, there are only a couple available, so please design, construct, and characterize new ones and submit them to the Registry!

*More...*
-?-		Name	Description	Direction	Length
A	W	BBa_J63002	ADH1 terminator from S. cerevisiae	Forward	225
M	?	BBa_K110012	STE2 terminator	Forward	123
A	W	BBa_K392003	yeast ADH1 terminator		129
		BBa_K801011	TEF1 yeast terminator		507
		BBa_K801012	ADH1 yeast terminator		349
		BBa_Y1015	CycE1		252

Caroline Ajo-Franklin developed the yeast terminator BBa_J63002 as a post-doc in Pam Silver's lab.