Ribosome Binding Sites/Prokaryotic/Constitutive/Anderson

The Anderson RBS family was contributed to the Registry by Prof. J. Christopher Anderson. (Photo: Peg Skorpinski)

Description

The Anderson RBS family are suitable for general protein expression in E. coli or other prokaryotes. The family is known to cover a range of translation initiation rates so by testing a few family members it should be possible to find a translation initiation rate that suits your application. The family of RBS were recovered from a library screen by Chris Anderson. In the original library, 6 nucleotide locations close to where the ribosome binds were randomized (see the master sequence below). The family members have not yet been quantitatively characterized (see the Characterization section below).

Obtaining Anderson RBS parts

The sequences of the Anderson RBS parts can be found in the table below. To obtain the physical DNA, we recommend two approaches -
Via de novo synthesis: Since the RBS parts are short sequences, they can be easily and cheaply ordered as two single-stranded complementary oligo's and annealed. See here for a tutorial on how to construct short parts via oligo annealing.

Via the Registry distribution: The RBS parts are included in the Registry distribution. These parts are cloned in plasmid pSB1A2, but there is also a constitutive promoter (derived from BBa_J23100) inserted into the XbaI site. So, for example, the EcoRI/PstI region of part BBa_J61100 reads:

...Biobrick Prefix..................J23100.................XbaI....RBS Part.....Biobrick Suffix...
gaattcgcggccgcttctagaGTTGACGGCTAGCTCAGTCCTAGGTACAGTGCTAGCTtctagaGAAAGAGGGGACAAactagtagcggccgctgcag

This feature in no way prevents the use of these parts in standard Biobrick assembly. Normal prefix insertion into EcoRI/XbaI will delete this promoter element. Suffix insertion into SpeI/PstI will retain this promoter, but it can of course be removed later by a prefix insertion. Note also that the T at the start of the BioBrick suffix was randomized during library construction and is therefore rarely a T. Because the Registry does not permit variation at this position, the Registry sequence of composite parts derived from these RBS will not match the physical sequence

Anderson RBS family members

Identifier Sequencea Predicted Strengthb
Mean CV
Master Sequence TCTAGAGAAAGANNNGANNNACTAGATG
BBa_J61100 TCTAGAGAAAGAGGGGACAAACTAGATG
BBa_J61101 TCTAGAGAAAGACAGGACCCACTAGATG
BBa_J61102 TCTAGAGAAAGATCCGATGTACTAGATG
BBa_J61103 TCTAGAGAAAGATTAGACAAACTAGATG
BBa_J61104 TCTAGAGAAAGAAGGGACAGACTAGATG
BBa_J61105 TCTAGAGAAAGACATGACGTACTAGATG
BBa_J61106 TCTAGAGAAAGATAGGAGACACTAGATG
BBa_J61107 TCTAGAGAAAGAAGAGACTCACTAGATG
BBa_J61108 TCTAGAGAAAGACGAGATATACTAGATG
BBa_J61109 TCTAGAGAAAGACTGGAGACACTAGATG
BBa_J61110 TCTAGAGAAAGAGGCGAATTACTAGATG
BBa_J61111 TCTAGAGAAAGAGGCGATACACTAGATG
BBa_J61112 TCTAGAGAAAGAGGTGACATACTAGATG
BBa_J61113 TCTAGAGAAAGAGTGGAAAAACTAGATG
BBa_J61114 TCTAGAGAAAGATGAGAAGAACTAGATG
BBa_J61115 TCTAGAGAAAGAAGGGATACACTAGATG
BBa_J61116 TCTAGAGAAAGACATGAGGCACTAGATG
BBa_J61117 TCTAGAGAAAGACATGAGTTACTAGATG
BBa_J61118 TCTAGAGAAAGAGACGAATCACTAGATG
BBa_J61119 TCTAGAGAAAGATTTGATATACTAGATG
BBa_J61120 TCTAGAGAAAGACGCGAGAAACTAGATG
BBa_J61121 TCTAGAGAAAGAGACGAGTCACTAGATG
BBa_J61122 TCTAGAGAAAGAGAGGAGCCACTAGATG
BBa_J61123 TCTAGAGAAAGAGATGACTAACTAGATG
BBa_J61124 TCTAGAGAAAGAGCCGACATACTAGATG
BBa_J61125 TCTAGAGAAAGAGCCGAGTTACTAGATG
BBa_J61126 TCTAGAGAAAGAGGTGACTCACTAGATG
BBa_J61127 TCTAGAGAAAGAGTGGAACTACTAGATG
BBa_J61128 TCTAGAGAAAGATAGGACTCACTAGATG
BBa_J61129 TCTAGAGAAAGATTGGACGTACTAGATG
BBa_J61130 TCTAGAGAAAGAAACGACATACTAGATG
BBa_J61131 TCTAGAGAAAGAACCGAATTACTAGATG
BBa_J61132 TCTAGAGAAAGACAGGATTAACTAGATG
BBa_J61133 TCTAGAGAAAGACCCGAGACACTAGATG
BBa_J61134 TCTAGAGAAAGACCGGAAATACTAGATG
BBa_J61135 TCTAGAGAAAGACCGGAGACACTAGATG
BBa_J61136 TCTAGAGAAAGAGCTGAGCAACTAGATG
BBa_J61137 TCTAGAGAAAGAGTAGATCAACTAGATG
BBa_J61138 TCTAGAGAAAGATATGAATAACTAGATG
BBa_J61139 TCTAGAGAAAGATTAGAGTCACTAGATG

aThe sequence of individual RBS are shown in black and red. The grey nucleotides show the bracketing sequence that results from assembling the RBS with an upstream part and a downstream coding sequence. The start codon of the downstream coding sequence is shown in green. See the "Obtaining Anderson RBS parts" section above for a description of how the physical DNA sequence of the Anderson RBS parts in the Registry differs slightly from BioBrick Assembly Standard 1.

Characterization

Measured strengths

042407pic1.jpg
Relative RFP levels from reporters using different clones from the RBS library (Click the chart for a larger version).
Raw data for the library after sequencing
Plate Reader data of the clones before repooling / FokI fragmentation

To date, the RBS library has not been experimentally characterized. This is largely a reflection of the method used to construct the library. Initiatially, all members of the library had the RBS variant upstream of an RFP gene. Red fluorescence for 384 individual library members, and the ranked activity of them is shown in the chart (right). All screened clones showing activity detectable above background were combined into 7 activity pools. Each pool underwent a procedure designed to remove the RFP gene and put back the SpeI site in each part. 96 individual processed clones were then sequenced, and the family of RBS parts reflects all the unique clones.

So, at this stage we really can't say much about their relative activity. All I can tell you is that they should all initiate translation at a rate above background, and they are very roughly in decreasing order of activity. RBS's with low numbers are likely to be stronger RBS's than those with higher numbers.

...and of course YOU could do some characterization and post the info here.

Note: The original nomenclature was Bca1050 and then Bca9110.

RESULTS TU Delft iGEM team 2010

RBS Strength
J61100 0.047513
J61101 0.119831
J61107 0.065454
J61117 0.038518
J61127 0.087334
B0032 0.300000