Registry:Feature requests
From partsregistry.org
• Add bug report • Add a note on Registry organization • New Features •
Feature request archive
(Newest posts at bottom)
- stroustr 4:20, 25 Jul 2006 (EDT): Is this page still active? It would be useful to be able to perform super-part searches for plasmid vectors as well as part contents. There doesn't seem to be an easy way to search for all constructs on low copy number plasmids, for example.
- Endy 11:35, 29 Jul 2005 (EDT): It would be great if there was a clear interface, or links to the already existing interface, for ordering (i) parts and (ii) parts assembly.
- Jkm 16:44, 8 Aug 2005 (EDT): Propagate changes in basic parts through their derived parts. See, for instance, I13457 (bases 76-85 reading ...ttactatctc...) and I13528 (bases 76-86 reading ...ttactactctc...). I13457 was created first, then modified with the sequence came back with a (minor) change. I13528 remains unchanged, though it explicitly derives from I13457.
- BC 11:34, 26 Sep 2005 (EDT): There seems to be some difficulties currently in renaming a part in the registry. In addition while editing the different sections of a part page independently has some advantages, there is also benefit in being able to rapidly create parts that are very similar or analagous by just copying and pasting all the data about one part. Currently, this has to be done in several steps.
- BC 15:06, 26 Sep 2005 (EDT): A related feature that might be desirable in the long term would be to allow the parallel creation of a family of composite parts that only vary in one of the parts. For example, a family of reporters each with a slightly different promoter. I'd like to be able to say, create ten parts simultaneously with each of the promoters R008X preceding E0240. X=1:10.
- Reshma 19:39, 3 Oct 2005 (EDT): More powerful searching of the registry. For instance, I want all parts of the form promoter.Q04400 where promoter can be any promoter. It would also be nice to specify whether you want any parts, just available parts or available and working parts. Perhaps this could be implemented via regular expression matching?
- BC 15:35, 8 Nov 2005 (EST): Primer design tools - It would be nice if I could enter a part number and specify two enzymes and the registry would generate sets of primers ready to PCR that part from an arbitrary piece of DNA with BioBrick ends that could be cut with the specified enzymes.
- Reshma 13:58, 16 Nov 2005 (EST)]: Enter features by simply pasting the sequence of the feature into a box. Then the registry would find that feature in the part sequence (on either strand) and auto-calculate the coordinates for you. You then enter the name of the feature separately. Ideally, it would be sophisticated enough to be able to cope with multiple instances of a feature sequence.
- Reshma 13:58, 16 Nov 2005 (EST): Blast results should include links from matches back to their registry page.
- BC 16:24, 22 February 2006 (EST): A forum to ask a question such as "Does anybody have sequencing primers for BBa_R00xx?" - a registry mailing list of all users might be the best way to do this?
- RS 13:03, 11 March 2006 (EST): Creation of a duplicate part in the reverse orientation. This would save a person from having to reenter all the features.
- RS 17:52, 30 April 2006 (EDT): Creation of a duplicate part with a new part number. This would save the user from having to reenter features when they create a new variant of an existing part.
- Bcanton 17:49, 6 June 2006 (EDT):It take more characters to write <partinfo>J01008</partinfo> than to write [[Part:BBa_J01008|J01008]]. Could the <partinfo> tags be renamed to <bb> maybe?
- Bcanton 18:05, 6 June 2006 (EDT): It would be nice if the name in the part designed field was a link to that users page or to a page listing all the parts designed by that person. Not critical by any means but it would be helpful in some situations.
- WingZero 21:08, 11 June 2006 (EDT): I've noticed that many people have a fondness for the JPEG format. I would ask that you please start using the PNG format. Refer to Wikipedia Policy if you don't know which format to use. As an example, take Image:Show more parts.jpg. There are hideous artifacts from the compression process. It's just plain blurry. I have uploaded Image:Show more parts.png which, not only looks better, but is smaller too.
- Drew 10:08, 15 June 2006 (EDT): It would be cool if the "designed by" field for parts was a link to a page listing all the parts designed by that person.
- Smelissali 10:21, 17 June 2006 (EDT): Design various templates for different types of parts?
- Smelissali 14:53, 18 June 2006 (EDT): It would be nice if under the "parts: hard information" pages, we could have a link that takes the user back to the appropriate parts table for editing.
- --Smelissali 18:26, 8 July 2006 (EDT): Implement a search that could search for parts in the manner of [RBS][coding region][terminator][regulatory]. This would eliminate the need for elaborate parts categorization as well
- Austen 20:25, 11 July 2006 (EST): When I am searching for parts using a superpart search I find a lot of parts that are not available...which is annoying. You should put available parts first followed by parts not yet available like you do when you brose parts by type.
- Done 7/26/2006 - Randy
- Austen 23:22, 11 July 2006 (EDT) Not possible to assemble biobricks that are fusion proteins. Standard biobrick assembly causes them to read out of frame. When are you going to enable fusion proteins that have no bp between coding sequence and restriction enzyme?
- Bcanton 17:02, 6 June 2006 (EDT): A useful feature would be to export the sequence of a part inserted into a BioBrick plasmid. This could then be annotated in your favorite sequence manipulation software.
- Drew 15:51, 7 June 2006 (EDT): This isn't a bug so much as an important new feature... the ability to export sequence information including annotation features in some standard format (e.g., genbank). Otherwise, it doesn't make sense for folks to use the Registry as a tool for annotating sequences (as the annotation information isn't exportable).
- RS 17:54, 26 February 2007 (EST): Why is there still not the ability to construct a part in the opposite orientation? This is ridiculous. The barrier to entering parts is too high!
- RS 18:25, 26 February 2007 (EST): Converting composite parts between scarless and BioBrick scar formats.
- Johncumbers 07:09, 20 November 2008 (UTC): I'd like to click a button and get the sequence of the part inside a particular vector, so I can import this into vector NTI, It's often useful for checking sequences and for making primers to amplify out parts.
- TK 18:13, 23 November 2008 (UTC) There should be a "usage" slot in the part description, to indicate how this part can be used, especially in combination with other parts.
- TK 18:13, 23 November 2008 (UTC) The idea of a cluster of parts needs to be supported. For example, the two ends of a transposon are best not thought of a separate parts, but as two pieces of a more complex object.
- TK 18:13, 23 November 2008 (UTC) There should be easy ways to input links to other parts in part descriptions.
- TK 18:13, 23 November 2008 (UTC) There should be an easy way to duplicate a part, so that families of parts with minor differences don't require editing and copying large amounts of inherited text.
- TK 18:13, 23 November 2008 (UTC) The part cluster idea needs to be supported in a way that users can create and edit the clusters.
- TK 18:13, 23 November 2008 (UTC) The bibliographic features of OWW should be supported to make it easier to add PubMed references, e.g.
- Wmholtz 04:16, 6 April 2009 (UTC) I just input experience reviews for the first time. The procedure is not intuitive. I'm a regular Mediawiki user, and I still had to look at the Registry help page to figure the process out. Perhaps there should be non-markup based way of entering experience reviews.
- GMcArthurIV 16:36, 17 May 2009 (UTC): I recommend installing a button on the main page (e.g., to the right of the "catalog of parts and devices" icon) that links to a "measurement" section that would have all the details about existing standard measurement methodologies, etc. A dedicated section may encourage/enable Registry users to improve existing methods or at least use the described protocols/tools to produce higher-quality, well-characterized parts. This would help emphasize the testing step of the engineering "design-build-test" cycle, which is usually overshadowed by the designing and building steps (this is true for iGEM projects, in particular).
- Norville 20:29, June 16, 2009 (UTC)
Add ability to see regions on the outside of parts (and to check for standard compatibility with these regions)
Assembly compatibility: 10 (your current standards interface with some new buttons below)
P-x-S (Prefix-part-Suffix)-this would be a green or red button as appropriate
(when you click on it you would go to the sequence)
P-x-R (Prefix-part-Scar)
R-x-S (Scar-part-Suffix)
for example when you click on a "green" P-x-R button for part R0040, you would get >Prefix-BBa_R0040-Scar (Standard 10) gaattcgcggccgcttctagag tccctatcagtgatagagattgacatccctatcagtgatagagatactgagcac tactaga(g or t)
- Norville 20:18, June 23, 2009 (UTC)
It would be nice to create an assembly tracker tool to track the conversion of assemblies into parts (this might be similar to the way that the registry tracks parts through different part collections. It would create trees to follow the assembly process and branches on the tree might turn green when a specific part is created. This could be linked to the final part and perhaps automatically generated or generated with help from the user
example RBS+gfp terminator vector I13500 B0014 pSB1AC3 pSB1A2 pSB1AK3 cut with ES cut with XP cut with EP spin pur spin purify spin pur | | | |____________|_____________| gfp translational unit (RBS, gfp, term) J70325 pSB1AC3
Requests for sequence information in other formats
- Download the sequence with annotated features of a part or assembly in genbank format.
- Bcanton 16:45, 5 June 2006 (EDT): Getting sequence information out of the registry is really awkward. I should be able to copy and paste the forward sequence, the reverse sequence, and the double stranded sequence easily. Right now, I can only get the forward strand sequence. On a related note, I know its been brought up by others but enabling the export/import of annotated genbank files would make the registry a significantly more useful tool.
- Malcolm Campbell 17:16, 13 October 2006 (EDT): I agree, I have had to do a lot of work to create dsDNA sequences and it should not take this much effort. Copy and paste dsDNA sequence would be a big help.
- I don't understand how cut and paste dsDNA would work. Forward or reverse is just a text file, but what would a ds text file look like? - Randy
- Malcolm Campbell 17:16, 13 October 2006 (EDT): I agree, I have had to do a lot of work to create dsDNA sequences and it should not take this much effort. Copy and paste dsDNA sequence would be a big help.
- Chowes 23:34, 7 May 2009: Download the sequence of the entire biobrick catalog in fasta format. Right now, we can blast against the database, but we can't download the database. I'll have to write some kind of spider program just to go to each part and get the sequence otherwise.
- Norvilles 00:10, 17 August 2009: It would be very useful to add an oligo part format (in addition to basic parts, composite, parts and intermediate parts. Oligo parts should be a set of two linked parts (for the forward and the reverse part) or one part that is defined with two strands.
for example it would be good to display both of these parts together on the same page or have them listed as one part with a forward and a reverse strand: BBa_J70326 B1001.f.1: B1001 forward oligo part
S: B1001.f.1: B1001 forward oligo part D: B1001 forward oligo part
BBa_J70327 B1001.r.1: B1001 reverse oligo part (single stranded)
S: B1001.r.1: B1001 reverse oligo part (single stranded) D: B1001 reverse oligo part (single stranded)
oligo parts should be displayed in single stranded form only and should contain a slot where either the user enters the TM or the program calculates it
it would be cool if the program could blast the oligos together and display them in double stranded format if they line up properly, but this may be too much

