

All the promoters on this page are E. coli promoters that are constitutive meaning that their activity is dependent on the availability of RNA polymerase holoenzyme, but is not affected by any transcription factors. If you find any promoters on this page that you know to be regulated by a particular transcription factor, please let us know, or re-categorize the part yourself!

Constitutive E. coli σ70 promoters

This section lists promoters that are recognized by E. coli σ70 RNAP. σ70 is the major E. coli sigma factor so there should be RNAP present to transcribe these promoters under most growth conditions (although maximally during exponential growth).

NameDescriptionPromoter SequencePositive
BBa_I14018P(Bla) . . . gtttatacataggcgagtactctgttatgg35742In stock
BBa_I14033P(Cat) . . . agaggttccaactttcaccataatgaaaca38763In stock
BBa_I14034P(Kat) . . . taaacaactaacggacaattctacctaaca45757In stock
BBa_I732021Template for Building Primer Family Member . . . acatcaagccaaattaaacaggattaacac1592217Not in stock
BBa_I742126Reverse lambda cI-regulated promoter . . . gaggtaaaatagtcaacacgcacggtgtta491006Not in stock
BBa_J01006Key Promoter absorbs 3 . . . caggccggaataactccctataatgcgcca591408Not in stock
BBa_J23100constitutive promoter family member . . . ggctagctcagtcctaggtacagtgctagc351409In stock
BBa_J23101constitutive promoter family member . . . agctagctcagtcctaggtattatgctagc35894In stock
BBa_J23102constitutive promoter family member . . . agctagctcagtcctaggtactgtgctagc35816In stock
BBa_J23103constitutive promoter family member . . . agctagctcagtcctagggattatgctagc35894In stock
BBa_J23104constitutive promoter family member . . . agctagctcagtcctaggtattgtgctagc35816In stock
BBa_J23105constitutive promoter family member . . . ggctagctcagtcctaggtactatgctagc35816In stock
BBa_J23106constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc351274In stock
BBa_J23107constitutive promoter family member . . . ggctagctcagccctaggtattatgctagc35894It's complicated
BBa_J23108constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc35816In stock
BBa_J23109constitutive promoter family member . . . agctagctcagtcctagggactgtgctagc351142In stock
BBa_J23110constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc35816In stock
BBa_J23111constitutive promoter family member . . . ggctagctcagtcctaggtatagtgctagc35816In stock
BBa_J23112constitutive promoter family member . . . agctagctcagtcctagggattatgctagc35816In stock
BBa_J23113constitutive promoter family member . . . ggctagctcagtcctagggattatgctagc35816In stock
BBa_J23114constitutive promoter family member . . . ggctagctcagtcctaggtacaatgctagc35816In stock
BBa_J23115constitutive promoter family member . . . agctagctcagcccttggtacaatgctagc35894In stock
BBa_J23116constitutive promoter family member . . . agctagctcagtcctagggactatgctagc35816In stock
BBa_J23117constitutive promoter family member . . . agctagctcagtcctagggattgtgctagc35816In stock
BBa_J23118constitutive promoter family member . . . ggctagctcagtcctaggtattgtgctagc35816In stock
BBa_J23119constitutive promoter family member . . . agctagctcagtcctaggtataatgctagc35816In stock
BBa_J231501bp mutant from J23107 . . . ggctagctcagtcctaggtattatgctagc35738In stock
BBa_J231511bp mutant from J23114 . . . ggctagctcagtcctaggtacaatgctagc35738Not in stock
BBa_J44002pBAD reverse . . . aaagtgtgacgccgtgcaaataatcaatgt130883In stock
BBa_J48104NikR promoter, a protein of the ribbon helix-helix family of trancription factors that repress expre . . . gacgaatacttaaaatcgtcatacttattt40780Not in stock
BBa_J54200lacq_Promoter . . . aaacctttcgcggtatggcatgatagcgcc50766Not in stock
BBa_J56015lacIQ - promoter sequence . . . tgatagcgcccggaagagagtcaattcagg57783Not in stock
BBa_J64951E. Coli CreABCD phosphate sensing operon promoter . . . ttatttaccgtgacgaactaattgctcgtg81800Not in stock
BBa_K088007GlnRS promoter . . . catacgccgttatacgttgtttacgctttg38813It's complicated
BBa_K119000Constitutive weak promoter of lacZ . . . ttatgcttccggctcgtatgttgtgtggac38796Not in stock
BBa_K119001Mutated LacZ promoter . . . ttatgcttccggctcgtatggtgtgtggac38850Not in stock
BBa_K1330002Constitutive promoter (J23105) . . . ggctagctcagtcctaggtactatgctagc35 In stock
BBa_K137029constitutive promoter with (TA)10 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt39802It's complicated
BBa_K137030constitutive promoter with (TA)9 between -10 and -35 elements . . . atatatatatatatataatggaagcgtttt37801It's complicated
BBa_K137031constitutive promoter with (C)10 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc62801It's complicated
BBa_K137032constitutive promoter with (C)12 between -10 and -35 elements . . . ccccgaaagcttaagaatataattgtaagc64801It's complicated
BBa_K137085optimized (TA) repeat constitutive promoter with 13 bp between -10 and -35 elements . . . tgacaatatatatatatatataatgctagc31824Not in stock
BBa_K137086optimized (TA) repeat constitutive promoter with 15 bp between -10 and -35 elements . . . acaatatatatatatatatataatgctagc33824Not in stock
BBa_K137087optimized (TA) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aatatatatatatatatatataatgctagc35824Not in stock
BBa_K137088optimized (TA) repeat constitutive promoter with 19 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc37824Not in stock
BBa_K137089optimized (TA) repeat constitutive promoter with 21 bp between -10 and -35 elements . . . tatatatatatatatatatataatgctagc39824Not in stock
BBa_K137090optimized (A) repeat constitutive promoter with 17 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc35823Not in stock
BBa_K137091optimized (A) repeat constitutive promoter with 18 bp between -10 and -35 elements . . . aaaaaaaaaaaaaaaaaatataatgctagc36823Not in stock
BBa_K1585100Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78 Not in stock
BBa_K1585101Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585102Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585103Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585104Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585105Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585106Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585110Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585113Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585115Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585116Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585117Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585118Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1585119Anderson Promoter with lacI binding site . . . ggaattgtgagcggataacaatttcacaca78  
BBa_K1824896J23100 + RBS . . . gattaaagaggagaaatactagagtactag88  
BBa_K256002J23101:GFP . . . caccttcgggtgggcctttctgcgtttata918752It's complicated
BBa_K256018J23119:IFP . . . caccttcgggtgggcctttctgcgtttata1167835It's complicated
BBa_K256020J23119:HO1 . . . caccttcgggtgggcctttctgcgtttata9491195It's complicated
BBa_K256033Infrared signal reporter (J23119:IFP:J23119:HO1) . . . caccttcgggtgggcctttctgcgtttata21245506It's complicated
BBa_K292000Double terminator + constitutive promoter . . . ggctagctcagtcctaggtacagtgctagc1381077It's complicated
BBa_K292001Double terminator + Constitutive promoter + Strong RBS . . . tgctagctactagagattaaagaggagaaa1611205It's complicated
BBa_K418000IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca1416737Not in stock
BBa_K418002IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca1414743It's complicated
BBa_K418003IPTG inducible Lac promoter cassette . . . ttgtgagcggataacaagatactgagcaca1416743It's complicated
BBa_K823004Anderson promoter J23100 . . . ggctagctcagtcctaggtacagtgctagc357233In stock
BBa_K823005Anderson promoter J23101 . . . agctagctcagtcctaggtattatgctagc357463In stock
BBa_K823006Anderson promoter J23102 . . . agctagctcagtcctaggtactgtgctagc357209In stock
BBa_K823007Anderson promoter J23103 . . . agctagctcagtcctagggattatgctagc357209In stock
BBa_K823008Anderson promoter J23106 . . . ggctagctcagtcctaggtatagtgctagc357209In stock
BBa_K823010Anderson promoter J23113 . . . ggctagctcagtcctagggattatgctagc357209In stock
BBa_K823011Anderson promoter J23114 . . . ggctagctcagtcctaggtacaatgctagc357209In stock
BBa_K823013Anderson promoter J23117 . . . agctagctcagtcctagggattgtgctagc357209In stock
BBa_K823014Anderson promoter J23118 . . . ggctagctcagtcctaggtattgtgctagc357209In stock
BBa_M13101M13K07 gene I promoter . . . cctgtttttatgttattctctctgtaaagg471011Not in stock
BBa_M13102M13K07 gene II promoter . . . aaatatttgcttatacaatcttcctgtttt481011Not in stock
BBa_M13103M13K07 gene III promoter . . . gctgataaaccgatacaattaaaggctcct481014Not in stock
BBa_M13104M13K07 gene IV promoter . . . ctcttctcagcgtcttaatctaagctatcg491013Not in stock
BBa_M13105M13K07 gene V promoter . . . atgagccagttcttaaaatcgcataaggta501010Not in stock
BBa_M13106M13K07 gene VI promoter . . . ctattgattgtgacaaaataaacttattcc491012Not in stock
BBa_M13108M13K07 gene VIII promoter . . . gtttcgcgcttggtataatcgctgggggtc471015Not in stock
BBa_M13110M13110 . . . ctttgcttctgactataatagtcagggtaa481010Not in stock
BBa_M31519Modified promoter sequence of g3. . . . aaaccgatacaattaaaggctcctgctagc60862Not in stock
BBa_R1074Constitutive Promoter I . . . caccacactgatagtgctagtgtagatcac74825Not in stock
BBa_R1075Constitutive Promoter II . . . gccggaataactccctataatgcgccacca49823Not in stock
BBa_S03331--Specify Parts List--ttgacaagcttttcctcagctccgtaaact30783Not in stock

Constitutive E. coli σS promoters

This section lists promoters that are recognized by E. coli σS RNAP. σS is the major stationary phase E. coli sigma factor. Use these promoters when you want high promoter activity during stationary phase or during starvation. Since σS promoters have the same consensus promoter sequence as σ70 promoters, you may find these promoters will be weakly expressed by σ70 RNAP.

NameDescriptionPromoter SequencePositive
BBa_J45992Full-length stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa1991651Not in stock
BBa_J45993Minimal stationary phase osmY promoter . . . ggtttcaaaattgtgatctatatttaacaa571660Not in stock

Constitutive E. coli σ32 promoters

This section lists promoters that are recognized by E. coli σ32 RNAP. σ32 is the major heat shock sigma factor in E. coli. Use these promoters when you want high promoter activity during heat shock. These promoters are also active under several different shock responses.

NameDescriptionPromoter SequencePositive
BBa_J45504htpG Heat Shock Promoter . . . tctattccaataaagaaatcttcctgcgtg405784Not in stock

Constitutive E. coli σ54 promoters

This section lists promoters that are recognized by E. coli σ54 RNAP. σ54 is a minor E. coli sigma factor that is most highly expressed during nitrogen-limitation. Use these promoters if you want promoter activity to depend on ammonia or nitrogen levels. Alternatively, since this is a minor sigma factor that recognizes promoters with a very different sequence to σ70 promoters, this sigma factor could be repurposed to be be expressed and active during some user-chosen set of environmental conditions, essentially producing a user controllable RNAP.

There are no parts for this table