Part:BBa_K530002:Design
From partsregistry.org
CRTI
- 10COMPATIBLE WITH RFC[10]
- 12COMPATIBLE WITH RFC[12]
- 21INCOMPATIBLE WITH RFC[21]Illegal BglII site found at 204
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
Design Notes
Part was PCR amplified from the genomic DNA created from the experiment and paper: High-Level Production of Beta-Carotene in Saccharomyces Cerevisiae by Successive Transformation with Carotenogenic Genes from Xanthophyllomyces Dendrorhous (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932764/). The PCR reaction performed also served to add the biobrick prefix and suffix to the terminator. PCR and tube contents This PCR was done with the use of Herculase Enzyme from Agilent.
| Reagents | Volume (uL) |
|---|---|
| Herculase 5X Buffer | 10 |
| 2.5mM dNTP | 5 |
| 100-300ng DNA | X |
| 10uM Forward Primer | 1.25 |
| 10uM Reverse Primer | 1.25 |
| Herculase II Enzyme | 1 |
| Sterile Water | Till Total |
| Total | 50 |
| Temperature (C) | Time | Cycles |
|---|---|---|
| 95 | 2 mins | 1 |
| 95 | 20 secs | 30 |
| 55 | 20 secs | 30 |
| 72 | 30 secs | 30 |
| 72 | 3 mins | 1 |
5ul of the sample were run on a gel with loading dye. The resulting gel confirmed the product was of the right size (841bp) to be the insert with the biobrick prefix and suffix now attached. The insert was then PCR purified and eluted with 10mM Tris HCl at ph7.4. Following the PCR purification, the inserts were digested with EcorI and SpeI.
| Reagents | Volume (uL) |
|---|---|
| NEB Buffer 4 | 3 |
| Insert | 25 |
| EcorI | 1 |
| SpeI | 1 |
| BSA | .3 |
The digestion mixture was then heat inactivated at 60 Celsius for 20 minutes. All 30uL were then loaded on a gel and gel extracted to ensure that the ssDNA removed by digestion doesn't religate. The gel piece was then gel purified through the use of Qiagen Gel Extraction Kit and eluted with 20uL Tris HCl at pH7.4.
Set the ligation overnight at 16 Celsius.
| Reagents | Volume (uL) |
|---|---|
| 10X T4 Lig. Buffer | 1.6 |
| Insert | 6 |
| Vector | 3 |
| T4 Ligase | 1 |
| Sterile Water | 3.5 |
5uL of ligation product was transformed into DH5 Alpha Competent Cells through heat shock. Cells were re-suspended in 450uL LB and placed in shaker for an hour. Cells were then plated in chloroamphenicol. Chloroamphenicol plates were allowed to grow overnight at 37 Celsius. 10 Colonies were picked 12-16 hours later and grown up in LB with chloroamphenicol.
2uL Sample of colonies was placed in 50uL sterile water and allowed to heat to 95 Celsius to separate DNA from cell biomass. After 10 minutes, the lysed sample is placed on ice for 5 minutes. Sample is then ready for csPCR.
| Reagents | Volume (uL) |
|---|---|
| Buffer | 10 |
| 2.5mM dNTP | 5 |
| 100-300ng DNA | X |
| 10uM Forward Seq. Primer | 1.25 |
| 10uM Reverse Seq. Primer | 1.25 |
| rTaq Polymerase | 1.25 |
| Sterile Water | Till Total |
| Total | 25 |
| Temperature (C) | Time | Cycles |
|---|---|---|
| 95 | 2 mins | 1 |
| 95 | 20 secs | 25 |
| 55 | 20 secs | 25 |
| 72 | 30 secs | 25 |
| 72 | 3 mins | 1 |
Colonies 1-6 and 8-10 showed a band of the correct size.
Sent colonies 1-4 for sequencing with the primers below:
Forward Primer: ccacctgacgtctaagaaac
Reverse Primer: tcactcaaaggcggtaatac
Source
Found in the genomic sequence of Xanthophyllomyces Dendrorhous. http://www.ncbi.nlm.nih.gov/nuccore/DQ016502.1
