DNA Planning
Experience: None
Get This Part
Coding

Part:BBa_K530001:Design

Designed by Daniel Wolozny   Group: Guests   (2011-08-01)

From partsregistry.org

CRTE

Assembly Compatibility:
  • 10
    COMPATIBLE WITH RFC[10]
  • 12
    COMPATIBLE WITH RFC[12]
  • 21
    INCOMPATIBLE WITH RFC[21]
    Illegal BglII site found at 335
    Illegal XhoI site found at 34
    Illegal XhoI site found at 166
    Illegal XhoI site found at 985
  • 23
    COMPATIBLE WITH RFC[23]
  • 25
    INCOMPATIBLE WITH RFC[25]
    Illegal AgeI site found at 202


Design Notes

Part was PCR amplified from the genomic DNA created from the experiment and paper: High-Level Production of Beta-Carotene in Saccharomyces Cerevisiae by Successive Transformation with Carotenogenic Genes from Xanthophyllomyces Dendrorhous (http://www.ncbi.nlm.nih.gov/pmc/articles/PMC1932764/). The PCR reaction performed also served to add the biobrick prefix and suffix to the terminator. PCR and tube contents This PCR was done with the use of Herculase Enzyme from Agilent.

Reagents Volume (uL)
Herculase 5X Buffer 10
2.5mM dNTP 5
100-300ng DNA X
10uM Forward Primer 1.25
10uM Reverse Primer 1.25
Herculase II Enzyme 1
Sterile Water Till Total
Total 50


Temperature (C) Time Cycles
95 2 mins 1
95 20 secs 30
55 20 secs 30
72 30 secs 30
72 3 mins 1


5ul of the sample were run on a gel with loading dye. The resulting gel confirmed the product was of the right size (841bp) to be the insert with the biobrick prefix and suffix now attached. The insert was then PCR purified and eluted with 10mM Tris HCl at ph7.4. Following the PCR purification, the inserts were digested with EcorI and SpeI.

Reagents Volume (uL)
NEB Buffer 4 3
Insert 25
EcorI 1
SpeI 1
BSA .3


The digestion mixture was then heat inactivated at 60 Celsius for 20 minutes. All 30uL were then loaded on a gel and gel extracted to ensure that the ssDNA removed by digestion doesn't religate. The gel piece was then gel purified through the use of Qiagen Gel Extraction Kit and eluted with 20uL Tris HCl at pH7.4.

Set the ligation overnight at 16 Celsius.

Reagents Volume (uL)
10X T4 Lig. Buffer 1.6
Insert 6
Vector 3
T4 Ligase 1
Sterile Water 3.5


5uL of ligation product was transformed into DH5 Alpha Competent Cells through heat shock. Cells were re-suspended in 450uL LB and placed in shaker for an hour. Cells were then plated in chloroamphenicol. Chloroamphenicol plates were allowed to grow overnight at 37 Celsius. 10 Colonies were picked 12-16 hours later and grown up in LB with chloroamphenicol.

2uL Sample of colonies was placed in 50uL sterile water and allowed to heat to 95 Celsius to separate DNA from cell biomass. After 10 minutes, the lysed sample is placed on ice for 5 minutes. Sample is then ready for csPCR.

Reagents Volume (uL)
Buffer 10
2.5mM dNTP 5
100-300ng DNA X
10uM Forward Seq. Primer 1.25
10uM Reverse Seq. Primer 1.25
rTaq Polymerase 1.25
Sterile Water Till Total
Total 25


Temperature (C) Time Cycles
95 2 mins 1
95 20 secs 25
55 20 secs 25
72 30 secs 25
72 3 mins 1


CrtE csPCR.png


Colonies 2, 4-5, 7-9 showed a band of the correct size.

Sent colony 2, 4, 7 and 8 for sequencing with the primers below:

Forward Primer: ccacctgacgtctaagaaac

Reverse Primer: tcactcaaaggcggtaatac

Source

Found in the genomic sequence of Xanthophyllomyces Dendrorhous. http://www.ncbi.nlm.nih.gov/nuccore/DQ016502.1

References