Part:BBa_K149001:Design
From partsregistry.org
Prp22 promoter
- 10COMPATIBLE WITH RFC[10]
- 21COMPATIBLE WITH RFC[21]
- 23COMPATIBLE WITH RFC[23]
- 25COMPATIBLE WITH RFC[25]
Background
PRP22 is a DEAH-box RNA-dependent ATPase which mediates the second catalytic step of splicing by releasing RNA from the spliceosome and unwinding RNA duplexes[1]. When promoter activity was verified basal expression was low; barely detectable above auto-fluorescence. To induce activity from this promoter, we hypothesized that the DNA-damaging agent methyl methanesulfonate (MMS) could increase activity at this locus. As the vast majority of alternatively spliced proteins in yeast are ribosomal protein-encoding genes [2], we believed that increased activity at this promoter is an essential characteristic to both maintain as well as possibly increase the level of ribosomes activity inside the cell, enabling the cell to cope with the increase protein and mRNA turnover. For this study, salt stress was selected as a negative control, to ensure that activity is dependent on structural damage, rather then just as a general stress-response.
Characterization
Biobrick characterization was performed by monitoring promoter activity in different high-stress environments. To perform this experiment, cells were first grown for 24 hours in Yeast Peptone Dextrose (YPD) supplemented with 2% glucose. The following day, cells were transferred to fresh YPD media supplemented with 2% glucose as well as the described concentration of methyl methanesulfonate or sodium chloride. Following 20 hours of growth in each respective environment, cell fluorescence was measured using a BeckmanCoulter FC500 MPL equipped with a 15-mW argon laser. yEGFP excitation was performed at 600v and detected using a 525±15 bandpass filter (FL1).
Results
Figure 1. Flow cytometry graphic comparing yEGFP expression under the PRP22 promoter to auto-fluorescence. The blue population highlights autofluorescence of the cell while prior to SSRE construct integration in BY4741. The population in red illustrates yEGFP expression under the PRP22 promoter when grown in YPD+2% glucose.
Figure 2. Flow cytometry measurements comparing yEGFP expression under the PRP22 when stimulated with methyl methane sulfonate. The blue population highlights yEGFP expression under the PRP22 promoter when grown in presence of 180uM MMS. The population in red illustrates yEGFP expression under the PRP22 promoter when grown in absence of MMS.
Figure 3. Flow cytometry measurements comparing yEGFP expression under the PRP22 when stimulated with methyl methane sulfonate. The blue population highlights yEGFP expression under the PRP22 promoter when grown in presence of 15M NaCl. The population in red illustrates yEGFP expression under the PRP22 promoter when grown in absence of NaCl.
Figure 4. Dose response curve of yEGFP expression in response to salt stress. Measurements illustrated are from no less the 3 experiments. The average standard deviation associated with this experiment is 2.35%.
Figure 5. Dose response curve of yEGFP expression in response to MMS. Measurements illustrated are from no less the 3 experiments. The average standard deviation associated with this experiment is 5.31%.
Source
The PRP22 promoter sequence was originally extracted from S. Cervisiae, using the 2 following primers: TAGTAGGATCCATTATTCTGGGCATCCGT;ATACTGAATTCCTCTAATATCTTTGTGTTACCTATGT. A BAMHI restriction site was included within the forward primer, while an EcoRV site was included within the reverse primer. This work was completed by our laboratory technician Simon St-Pierre.
References
1. Schwer, B., Gross, C.H. Prp22, a DExH-box RNA helicase, plays two distinct roles in yeast pre-mRNA splicing (1998) EMBO Journal, 17 (7), pp. 2086-2094.
2. Pleiss, J.A., Whitworth, G.B., Bergkessel, M., Guthrie, C. Rapid, Transcript-Specific Changes in Splicing in Response to Environmental Stress (2007) Molecular Cell, 27 (6), pp. 928-937.
Biobrick Preparation
- pSB1A2 plasmid containing the BBa_p1010 cell death gene recieved from MIT in ecoli. Miniprep of pSB1A2 plasmid performed.
- Digestion of the minipreppred pSB1A2 performed using the followong reaction mixture: 25 ul of DNA, 5ul of BSA, 5 ul of Buffer 3, 1 ul EcoRI, 1 ul PstI, 13 ul H2O.
- pSB1A2 digested for 1 hr at 37C in ecoli incubator.
- A second confirmation was performed through plasmid sequencing.






