Collections/Metal

This collection is under curation by iGEM HQ. New parts and information are currently being added to this page.

iGEM Teams and Labs have completed a variety of biosensors and bioremediation projects that involve metal-binding and metal-sensing. Metals that iGEM teams have worked with include: nickel, mercury, lead, arsenic, copper, amongst others.


The collection below includes DNA parts that are responsible for both metal binding and metal sensing.


Previous iGEM Metal Projects

The following table contains iGEM teams that have worked with a variety of metals, along with links to their project wiki and Registry parts. This is not an exhaustive list.

Team Year Parts Project As Au Cd Co Cr Cu Fe Pb Hg Ni Zn
Bielefeld-CeBiTec 2015 Parts Cell-free Sticks - It works on paper na na na na Yes Yes na Yes Yes Yes na
Gaston_Day_School 2015 Parts ~ na na Yes na na na na na na na na
LZU-China 2015 Parts Micro Holmes: —A Novel device for Monitoring Heavy Metal Ions na na na na Yes Yes na na na na na
Nanjing-China 2015 Parts Metallosniper: —innovative total solution for heavy metals na Yes na na na na na Yes na na na
SCUT 2015 Parts Super Cadmium Ion Killer: Engineering E.coli to adsorb cadmium ion during the sewage treatment process na na Yes na na na na na na na na
UMBC-Maryland 2015 Parts Copper Bioremediation Using Genetically Engineered E. Coli na na na na na Yes na na na na na
UMBC-Maryland 2015 Parts Copper Bioremediation Using Genetically Engineered E. Coli na na na na na Yes na na na na na
Berlin 2014 Parts A remote control for E. coli na na na na na na Yes na na na na
BIOSINT Mexico 2014 Parts Green Demon na na na na na na na na Yes na na
Cornell 2014 Parts Lead it go: Heavy metal sequestration from regional contaminated waters using genetically engineered E.coli na na na na na na na Yes Yes Yes na
HUST-China 2014 Parts Warlord E.CaoMengde - a tale of 3 pollutants treatment na na na na na Yes na na na na na
INSA-Lyon 2014 Parts CurLy’on na na na Yes na na na na na Yes na
Minnesota 2014 Parts Mntallica: Engineering Bacteria for Mercury and Heavy Metal Bioremediation na na na na na na na na Yes na na
Nagahama 2014 Parts One E.coli has one function theory na na Yes na na na na na na na na
NEFU China 2014 Parts Nanocrystal E.coli Flocculation Union na na Yes na na na na na na na Yes
Penn 2014 Parts Cadmium recovery by a recombinant Magnetospirillum magneticum AMB-1 na na Yes na na na na na na na na
UFAM Brazil 2014 Parts Mercury Bacter na na na na na na na na Yes na na
York 2014 Parts EcoCADMUS (E. coli CAdmium DecontaMination Universal System) na na Yes na na na na na na na na
Edinburgh 2013 Parts WastED na na na na na na Yes na na na na
Gaston Day School 2013 Parts Fluorescent Detection of Cadmium in Water Supplies na na Yes na na na na na na na na
Gaston Day School 2012 Parts Detection of Heavy Metal Contaminants in Water Yes na Yes na na na na Yes na na na


Metal Binding Proteins

This set includes coding regions (CDS, Translational Units, Protein Domains) for proteins that bind various metal ions.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K190019fMT 222Nienke Kuipers34962Translational_UnitIn stock
BBa_K205004MerT - Membranous Mercury transporter 351Katelin Haynes874 CodingIn stock
BBa_K519010SmtA171Kotone Miyake18815CodingIn stock
BBa_K1420001merA, mercuric reductase from Serratia marcescens1686Stephen C. Heinsch  CodingIn stock
BBa_K1509000Coding for the trans-acting regulator SmtB369Tong Li  CodingIn stock
BBa_K1505000RBS+mntH1324Renyao Wei  Translational_UnitIn stock
BBa_K1393001OprF(Ala196)+CBP609Jiajun Tan  CodingIn stock
BBa_K1342003SmtA Part171Naoki Saito,Daiki Haraguchi,Yoshiharu Otaki,Ryuhei Minei   CodingIn stock
BBa_K1438001Bacterioferritin (BFR) M52H heme-deletion477Johann Bauerfeind  CodingIn stock
BBa_K1438002Hu_Ferritin1077Johann Bauerfeind  CodingIn stock
BBa_K1420002merB, Organomercurial Lyase from Serratia marcescens639Stephen C. Heinsch 2CodingIn stock
BBa_K1420003MerP, mercuric transport protein periplasmic component276Stephen C. Heinsch  CodingIn stock
BBa_K1420005merT, mercuric transport protein351Stephen C. Heinsch  CodingIn stock
BBa_K1505002RBS+mntH+mCerulean2034Jane Shmushkis, Amey Vrudhula  Translational_UnitIn stock
BBa_I721002Lead Binding Protein399Jeffrey Hofmann27387CodingIt's complicated
BBa_K231000Metal binding peptide51Daniel R Tarjan1626 CodingIt's complicated
BBa_K346001RBS (B0034) + MerR (mercury-responsive transcription factor)453Ao Liu & Ying Sheng31379Translational_UnitIt's complicated
BBa_K346003RBS(B0032)+MBP(mercury metal binding peptide engineered from MerR)342Huyang Tengxin41121Translational_UnitIt's complicated
BBa_K643000CDS7 cadmium sulfate binding peptide coding sequence71Sung won Lim4510 CodingIt's complicated
BBa_K643002J140 metal binding peptide53Rikki Frenkel, Justin Fabrikant975 CodingIt's complicated
BBa_K1122666Ferric uptake repressor450Hugo Villanueva18882CodingIt's complicated
BBa_K1122702Ferric ion-binding protein (FbpA)999Harry Thornton1629 CodingIt's complicated
BBa_K1122703Ferric ion-binding protein (FbpA) without a signal peptide936Harry Thornton1667 CodingIt's complicated
BBa_K1438000Bacterioferritin (BFR)513Johann Bauerfeind  CodingIt's complicated
BBa_K1393000OprF(Val188)+GS linker+CBP600Jiajun Tan  CodingIt's complicated
BBa_K1471000MerE.180Juan No Hernndez Salazar 3CodingIt's complicated
BBa_K1471001MerB.639Jaime Antonio del Castillo Nuez 3CodingIt's complicated
BBa_K1420004merR family transcriptional regulator, regulatory protein for mer operon435Stephen C. Heinsch 2CodingIt's complicated
BBa_K1505001RBS+smtA+mCherry977Renyao Wei  Translational_UnitIt's complicated
BBa_K1438035PPMT Sascha Kaufmann  CodingNo part sequence
BBa_K1701000GolB195Wei Wei  Coding 
BBa_K1694006 Gold Binding Polypeptide132CHIH-HSUAN HSU  Coding 
BBa_K1980000TAT Copper Storage Protein 1 474Sam Garforth -1Coding 
BBa_K1980001TAT Copper Storage Protein 1 sfGFP1203Sam Garforth -1Coding 
BBa_K1980003MymT sfGFP912Sam Garforth -1Coding 
BBa_K1980002MymT183Sam Garforth -1Coding 
BBa_K2127001Inducible High Expression His-Tagged Photosystem II CP47 subunit2071Nafaa Haddou -1Coding 
BBa_K2127002CP47 His-tagged with Lac Promoter1886Dawson Zeng -1Coding 
BBa_K2127004CP-47-HIS TAG1548Mirat Sojitra -1Coding 
BBa_K160001Fe-Receptor2244RAUL CUERO760 CodingNot in stock
BBa_K190020MymT180Nienke Kuipers971 Translational_UnitNot in stock
BBa_K190021SmtA189Nienke Kuipers8952Translational_UnitNot in stock
BBa_K1438003PPMT_GS_ATPCS1704Johann Bauerfeind  CodingNot in stock
BBa_K1550004BmtA (Lead/Zinc-binding metallothionein from Oscillatoria brevis, codon optimized for E. coli)165Jesse Goldenberg 2CodingNot in stock
BBa_K1701001PbrR438Wei Wei  CodingNot in stock


Metal Binding Composite Parts

This set includes composite parts that bind various metal ions.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K346004RBS(B0034)_MBP(lead metal binding peptide egineered from PbrR)+Terminator(B0015)479Junyi Jiao25462CompositeIn stock
BBa_K1460001pT7 + RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter1028Eric Holmes 3CompositeIn stock
BBa_K1460002RBS + GST (glutathione-S-transferase)-CRS5 (metallothionein) + Ter970Eric Holmes  CompositeIn stock
BBa_K1460003Anderson Promoter + NixA + Ter1029Eric Holmes 1CompositeIn stock
BBa_K1460004Anderson Promoter + MerT + MerP + ter741Eric Holmes 1CompositeIn stock
BBa_K1404002Ptac-NiCoTB, improves nickel and cobalt internalization1306Alexandre Duprey 1GeneratorIn stock
BBa_K1355000Strong RBS + merA (mercuric ion reductase)+ terminator (BBa_ B0015) 1778Maria Clara Astolfi, Luna Barroco de Lacerda 1CompositeIn stock
BBa_K1355001Regulation and transport of mercury ions1189Maria Clara Astolfi, Luna Barroco de Lacerda 3GeneratorIn stock
BBa_K519011SmtA-Double Term.308Kotone Miyake15281CompositeIt's complicated
BBa_K1526007LacRS + MntH2676Cau Westmann  CompositeIt's complicated
BBa_K1980010pCopA TAT Csp1 sfGFP with divergent CueR1783Sam Garforth -1Other 
BBa_K1980011pCopA MymT with divergent expressed CueR763Sam Garforth -1Device 
BBa_K1980012pCopA MymT sfGFP with divergent CueR1492Sam Garforth -1Device 
BBa_K1460005Anderson Promoter + RBS + CBP42189Eric Holmes 1CompositeNot in stock
BBa_K1460006Anderson Promoter + nixA + Ter + pT7 + GST-CRS5 + Ter2065Eric Holmes  CompositeNot in stock
BBa_K1460007Anderson Promoter + merT + merP + Ter + pT7 + GST-CRS5 + Ter1777Eric Holmes  CompositeNot in stock
BBa_K1460008Anderson Promoter + CBP4 + pT7 + GST-CRS5 + Ter3225Eric Holmes  CompositeNot in stock


Metal Sensitive Promoters/Regulatory

This set includes promoters that are sensitive to various metals. The promoters are typically regulated by a receptor protein that binds to the metal ion or complex.


More...
NameDescriptionPromoter SequencePositive
Regulators
Negative
Regulators
LengthDocStatus
BBa_I721001Lead Promoter . . . gaaaaccttgtcaatgaagagcgatctatg942886It's complicated
BBa_I731004FecA promoter . . . ttctcgttcgactcatagctgaacacaaca90540Not in stock
BBa_I760005Cu-sensitive promoteratgacaaaattgtcat161267Not in stock
BBa_I765000Fe promoter . . . accaatgctgggaacggccagggcacctaa1044793It's complicated
BBa_J3902PrFe (PI + PII rus operon) . . . tagatatgcctgaaagcgcataccgctatg272805It's complicated
BBa_K1122069Ferric uptake repressor boxtgataatcattatca15855Not in stock
BBa_K1163101pAceB promoter region . . . gttttcggatccatgacgaggagctgcacg3001915Not in stock
BBa_K1163107Fes promoter region . . . atggcccggaatggcagcgtctgaatgacg2981316Not in stock
BBa_K1163110YncE promoter region . . . aaaaatatcggttcatcaaagggagtcgtc3001318Not in stock
BBa_K1342005zinTp (Cd2+ sensing promoter) (Fw:Lac promoter(-) ver.) . . . attacacatcatatacattaactctggagg81 In stock
BBa_K1509001A bi-directional promoter affected by SmtB protein . . . gttattcagatattcaaaggagttgctgtc100 In stock
BBa_K1724000Pcada . . . tgactctgtagttgctacagggtgtgcaat31  
BBa_K174016Promoterless ArsR binding siteagtaatcaaaataaattgatttattt261098Not in stock
BBa_K174017CadA promoter with CzrA binding site . . . aagctaagaggaggaactactatggctagc1711216Not in stock
BBa_K1980004pCusC promoter . . . agagcctggcgagtaaagttggcggcataa98  
BBa_K1980006pCopA with divergent expressed CueR . . . taacctttatcatactagaaagaggagaaa574  
BBa_K346002PmerT promoter (mercury-responsive) . . . gtacggaagtaaggttacgctatccaatcc573310In stock
BBa_K346054PpbrA promoter . . . ctagagggtgttaaatcggcaacgcgagaa561011It's complicated
BBa_K540001rcn, cobalt-sensitive promoter . . . atcatgaccgaatttacaactcttcttcag4265249In stock
BBa_K896008zinTp (Cd2+ sensing promoter) . . . attacacatcatatacattaactctggagg81994In stock


Metal Sensitive Composite Parts

This set includes composite parts that are sensitive to various metals. These composite parts generally contain a metal sensitive promoter.


More...
NameDescriptionLengthCreated byDocumentationUsesTypeStatus
BBa_K1460009Prcn + amilCP1101Eric Holmes  CompositeNot in stock
BBa_K1460010PmerT + amilCP732Eric Holmes  CompositeNot in stock
BBa_K1749000Cd sensitive promoter with Phi delta activator, PO promoter, and GFP1440Anne Byford  Composite 
BBa_K1755301copper promoter + RBS + ribB + terminator840Haotian Wang  MeasurementNot in stock
BBa_K1755302copper promoter + RBS + ribB + terminator888Haotian Wang  MeasurementNot in stock
BBa_K1755303cobalt sensor1243Haotian Wang  MeasurementNot in stock
BBa_K1755305Hg Sensor841Haotian Wang  Measurement 
BBa_K1758312Chromium responsive promoter with UTR+RBS and sfGFP 1073Team Bielefeld-CeBiTec 2015 2Generator 
BBa_K1758313Chromium repressor under control of constitutive promoter and strong RBS,chromium responsive promote2081Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758314Chromium responsive promoter under T7-promoter with UTR-sfGFP 1104Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758321mRFP under control of copper responsive promoter770Team Bielefeld-CeBiTec 2015 1Generator 
BBa_K1758322Copper activator under control constitutive promoter and strong RBS and Copper responsive promoter w1247Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758323UTR-sfGFP under control of Copper responsive promoter 992Team Bielefeld-CeBiTec 2015 2Generator 
BBa_K1758325Copper responsive promoter with T7-promoter and UTR-sfGFP 1023Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758331Lead responsive promoter with mRFP755Team Bielefeld-CeBiTec 2015 1Generator 
BBa_K1758332Lead responsive promoter with UTR-sfGFP 977Team Bielefeld-CeBiTec 2015 2Generator 
BBa_K1758333Lead repressor under control of constitutive promoter and strong RBS and lead responsive promoter wi1484Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758334Lead responsive promoter with T7-promoter and UTR-sfGFP 1008Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758335UTR-sfGFP controlled by T7-promoter and lead responsive promoter786Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758342Mercury responsive promoter with UTR-sfGFP 966Team Bielefeld-CeBiTec 2015 1Generator 
BBa_K1758343MerR activator under constitutive promoter and induceble merT promoter with 5 UTR -sfGFP1470Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758344Mercury responsive promoter with T7-promoter and UTR-sfGFP 989Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1758351Nickel responsive promoter with RFP791Team Bielefeld-CeBiTec 2015  Generator 
BBa_K1758352Nickel responsive promoter with UTR-sfGFP 1013Team Bielefeld-CeBiTec 2015 2Generator 
BBa_K1758353Nickel repressor under control of constitutive promoter and strong RBS and Nickel responsive promote1353Team Bielefeld-CeBiTec 2015  Generator 
BBa_K1758354 Nickel responsive promoter with T7-promoter and UTR-sfGFP1042Team Bielefeld-CeBiTec 2015  Composite 
BBa_K1980005pCopA sfGFP810Sam Garforth -1ReporterIt's complicated
BBa_K1980007pCusC mKate2824Sam Garforth -1Reporter 
BBa_K1980008pCopA CueR sfGFP/ feedback pCopA sfGFP1252Sam Garforth -1Reporter 
BBa_K1980009pCusC CusR RFP1554Sam Garforth -1Reporter 
BBa_K1980010pCopA TAT Csp1 sfGFP with divergent CueR1783Sam Garforth -1Other 
BBa_K1980011pCopA MymT with divergent expressed CueR763Sam Garforth -1Device 
BBa_K1980012pCopA MymT sfGFP with divergent CueR1492Sam Garforth -1Device 
BBa_K824008Cadmium Promoter with GFP Reporter 1068Steven Allen1214 CompositeIt's complicated
BBa_K824009Arsenic Promoter with GFP Reporter (Arsenic Detector)1381Steven Allen1276 CompositeIt's complicated
BBa_K824012Lead Promoter with GFP Reporter (Lead Detector)957Steven Allen1189 CompositeIt's complicated