Cell-cell signalling
From partsregistry.org
| Promoters (?) | Transcriptional regulators (?) | Enzymes (?) | Translational units (?) | Composite parts |
Promoters
These promoters are all related to cell signalling. Cell signalling is often mediated by a small molecule or peptide that diffuses between cells and can diffuse through cell membranes. The signalling molecule is recognized by a receptor protein (often located in or near the membrane of the cell) that regulates the activity of the promoters listed here directly, or via a signalling cascade.
| -?- | Name | Description | Promoter Sequence | Positive Regulators | Negative Regulators | |
|---|---|---|---|---|---|---|
| A | BBa_I1051 | Lux cassette right promoter | . . . tgttatagtcgaatacctctggcggtgata | |||
1 | BBa_I14015 | P(Las) TetO | . . . ttttggtacactccctatcagtgatagaga | |||
| 1 | BBa_I14016 | P(Las) CIO | . . . ctttttggtacactacctctggcggtgata | |||
| 1 | BBa_I14017 | P(Rhl) | . . . tacgcaagaaaatggtttgttatagtcgaa | |||
| BBa_I739105 | Double Promoter (LuxR/HSL, positive / cI, negative) | . . . cgtgcgtgttgataacaccgtgcgtgttga | ||||
| 1 | BBa_I746104 | P2 promoter in agr operon from S. aureus | . . . agattgtactaaatcgtataatgacagtga | |||
| W | BBa_I751501 | plux-cI hybrid promoter | . . . gtgttgatgcttttatcaccgccagtggta | |||
| W | BBa_I751502 | plux-lac hybrid promoter | . . . agtgtgtggaattgtgagcggataacaatt | |||
| A | BBa_I761011 | CinR, CinL and glucose controlled promotor | . . . acatcttaaaagttttagtatcatattcgt | |||
| BBa_J06403 | RhIR promoter repressible by CI | . . . tacgcaagaaaatggtttgttatagtcgaa | ||||
| A | BBa_J102001 | Reverse Lux Promoter | . . . tcttgcgtaaacctgtacgatcctacaggt | |||
| BBa_J64000 | rhlI promoter | . . . atcctcctttagtcttccccctcatgtgtg | ||||
| BBa_J64010 | lasI promoter | . . . taaaattatgaaatttgcataaattcttca | ||||
| BBa_J64067 | LuxR+3OC6HSL independent R0065 | . . . gtgttgactattttacctctggcggtgata | ||||
| BBa_J64712 | LasR/LasI Inducible & RHLR/RHLI repressible Promoter | . . . gaaatctggcagtttttggtacacgaaagc | ||||
| 1 | BBa_K091107 | pLux/cI Hybrid Promoter | . . . acaccgtgcgtgttgatatagtcgaataaa | |||
| A | BBa_K091117 | pLas promoter | . . . aaaattatgaaatttgtataaattcttcag | |||
| 1 | BBa_K091143 | pLas/cI Hybrid Promoter | . . . ggttctttttggtacctctggcggtgataa | |||
| 1 | BBa_K091146 | pLas/Lux Hybrid Promoter | . . . tgtaggatcgtacaggtataaattcttcag | |||
| W | BBa_K091156 | pLux | . . . caagaaaatggtttgttatagtcgaataaa | |||
| BBa_K091157 | pLux/Las Hybrid Promoter | . . . ctatctcatttgctagtatagtcgaataaa | ||||
| 1 | BBa_K145150 | Hybrid promoter: HSL-LuxR activated, P22 C2 repressed | . . . tagtttataatttaagtgttctttaatttc | |||
| A | W | BBa_K266000 | PAI+LasR -> LuxI (AI) | . . . caccttcgggtgggcctttctgcgtttata | ||
| A | W | BBa_K266005 | PAI+LasR -> LasI & AI+LuxR --| LasI | . . . aataactctgatagtgctagtgtagatctc | ||
| A | W | BBa_K266006 | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | . . . caccttcgggtgggcctttctgcgtttata | ||
| A | W | BBa_K266007 | Complex QS -> LuxI & LasI circuit | . . . caccttcgggtgggcctttctgcgtttata | ||
| W | BBa_K658006 | position 3 mutated promoter lux pR-3 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | |||
| W | BBa_K658007 | position 5 mutated promoter lux pR-5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | |||
| W | BBa_K658008 | position 3&5 mutated promoter lux pR-3/5 (luxR & HSL regulated) | . . . caagaaaatggtttgttatagtcgaataaa | |||
| 1 | BBa_R0061 | Promoter (HSL-mediated luxR repressor) | ttgacacctgtaggatcgtacaggtataat | |||
| 1 | BBa_R0062 | Promoter (luxR & HSL regulated -- lux pR) | . . . caagaaaatggtttgttatagtcgaataaa | |||
| 1 | BBa_R0063 | Promoter (luxR & HSL regulated -- lux pL) | . . . cacgcaaaacttgcgacaaacaataggtaa | |||
| 1 | BBa_R0071 | Promoter (RhlR & C4-HSL regulated) | . . . gttagctttcgaattggctaaaaagtgttc | |||
| 1 | BBa_R0078 | Promoter (cinR and HSL regulated) | . . . ccattctgctttccacgaacttgaaaacgc | |||
| 1 | BBa_R0079 | Promoter (LasR & PAI regulated) | . . . ggccgcgggttctttttggtacacgaaagc | |||
| 1 | BBa_R1062 | Promoter, Standard (luxR and HSL regulated -- lux pR) | . . . aagaaaatggtttgttgatactcgaataaa | |||
Transcriptional regulators
Transcriptional regulators either activate or repress transcription from cognate promoters.
| -?- | Name | Protein | Description | Tag | Direction | Uniprot | KEGG | Operator | Ligand | Length | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | BBa_C0062 | LuxR | luxR repressor/activator, (no LVA?) | None | Forward | P12746 | 781 | ||||
| 1 | BBa_C0071 | rhlR-LVA | rhlR repressor/activator from P. aeruginosa PA3477 (+LVA) | LVA | Forward | P54292 | 787 | ||||
| 1 | BBa_C0079 | lasR-LVA | lasR activator from P. aeruginosa PAO1(+LVA) | LVA | Forward | P25084 | 781 | ||||
| 1 | BBa_C0077 | cinR | cinR activator from Rhizobium leguminosarum (+LVA) | LVA | Forward | ~ Q84HT2 | 787 | ||||
| 1 | BBa_C0171 | rhIR | rhlR repressor/activator from P. aeruginosa PA3477 (no LVA) | None | Forward | P54292 | 729 | ||||
| 1 | BBa_C0179 | lasR | lasR activator from P. aeruginosa PAO1(no LVA) | None | Forward | P25084 | 723 | ||||
| 1 | BBa_K131022 | LuxO D47E, Vibrio harveyi | 1362 | ||||||||
| 1 | BBa_K131023 | LuxO D47A, Vibrio harveyi | 1362 | ||||||||
| A | W | BBa_K082006 | LuxR-G2F | 753 | |||||||
| A | BBa_K266002 | lasR-LVA | LasR + Term | LVA | Forward | P25084 | 918 | ||||
| BBa_S04301 | lasR-LVA | C0079:B0015 | LVA | Forward | P25084 | 918 | |||||
| BBa_K783054 | lasR-LVA | This is a MoClo converted version of BBa_C0079 | LVA | Forward | P25084 | 756 | |||||
Enzymes
< Back to Biosynthesis Protein coding sequences
N-Acyl Homoserine lactones (AHLs or N-AHLs) are a class of signaling molecules involved in bacterial quorum sensing. Quorum sensing is a method of communication between bacteria that enables the coordination of group based behavior based on population density. In synthetic biology, genetic parts derived from quorum sensing systems have been used to create patterns on a lawn of bacteria and to achieve synchronized cell behavior. AHL can diffuse across cell membranes and is stable in growth media over a range of pH values. AHL can bind to transcriptional activators such as LuxR and stimulate transcription from cognate promoters. Several similar quorum sensing systems exists across different bacterial species; thus, there are several known enzymes that synthesize or degrade different AHL molecules. Note that genetic parts derived from different quorum sensing systems may have different levels of crosstalk.
Biosynthesis
| -?- | Name | Protein | Description | Direction | Uniprot | KEGG | E.C. | Substrate | Product | Length | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | BBa_C0061 | luxI-LVA | autoinducer synthetase for AHL | Forward | P12747 | none | none | 643 | |||
| 1 | BBa_C0060 | aiiA-LVA | autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone | Forward | Q1WNZ5 | none | 3.1.1.- | 814 | |||
| 1 | BBa_C0070 | rhlI-LVA | autoinducer synthetase for N-butyryl-HSL (BHL) and HHL | Forward | Q02QW5 | none | none | 667 | |||
| 1 | BBa_C0076 | cinI | autoinducer synthetase | Forward | Q1MDW1 | none | none | 727 | |||
| 1 | BBa_C0078 | lasI | autoinducer synthetase for PAI from Pseudomonas aeruginosa | Forward | P33883 | pae:PA1432 | none | 667 | |||
| 1 | BBa_C0161 | luxI | autoinducer synthetase for AHL (no LVA) | Forward | P12747 | none | none | 585 | |||
| 1 | BBa_C0170 | rhII | autoinducer synthetase for N-butyryl-HSL (BHL) and HHL (no LVA) | Forward | Q02QW5 | none | none | 609 | |||
| 1 | BBa_C0178 | lasI | autoinducer synthetase for PAI from Pseudomonas aeruginosa (no LVA) | Forward | P33883 | pae:PA1432 | none | 609 | |||
| A | W | BBa_K091109 | LuxS | 516 | |||||||
Degradation
| -?- | Name | Protein | Description | Direction | Uniprot | KEGG | E.C. | Substrate | Product | Length | |
|---|---|---|---|---|---|---|---|---|---|---|---|
| 1 | BBa_C0060 | aiiA-LVA | autoinducer inactivation enzyme from Bacillus; hydrolyzes acetyl homoserine lactone | Forward | Q1WNZ5 | none | 3.1.1.- | 814 | |||
| 1 | BBa_C0160 | aiiA | autoinducer inactivation enzyme aiiA (no LVA) | Forward | Q1WNZ5 | none | 3.1.1.- | 756 | |||
Translational units
Translational units begin with the RBS, the site of ribosome binding and translational initiation, and end with a stop codon, the site of translational termination. Every translational unit in the Registry consists of at least three parts, a Translational start, one or more Internal Domains including Special Internal Domains, and a Tail Domain. Thus translational units can, in some sense, be thought of as a composite part made up of three or more parts. Protein coding sequences, in contrast, begin with a start codon and end with a stop codon.
For more information on protein domains, see protein domains. Unfortunately, the original BioBrick assembly standard, Assembly standard 10, does not support in-frame assembly of protein domains. (Assembly standard 10 creates an 8 bp scar between adjacent parts.) Therefore, it is recommended that you use an alternate approach to assemble protein domains together to make a translational unit. There are several possible approaches to assembling protein domains including direct synthesis (preferred because it creates no scars) as well as various assembly standards. Regardless of which standard you choose, we suggest that the resulting translational unit comply with the original BioBrick assembly standard so that your parts can be assembled with most of the parts in the Registry.
Translational units should be as follows
GAATTC GCGGCCGC T TCTAGA G [RBS] [ATG ... TAA TAA] T ACTAGT A GCGGCCG CTGCAG
Although most RBSs are currently specified as separate parts in the Registry, we are now moving to a new design in which the RBS and Head domain are combined into a single part termed a Translational start. The new design has the advantage of encapsulating both ribosome binding and translational initiation within a single part. Our working hypothesis is that the new design will reduce the likelihood of unexpected functional composition problems between the RBS and coding sequence.
| -?- | Name | Protein | Description | Tag | Direction | UniProt | KEGG | Length | |
|---|---|---|---|---|---|---|---|---|---|
| A | BBa_I9026 | rhlI translational unit | 685 | ||||||
| A | BBa_C0260 | aiiA | autoinducer inactivation enzyme, AaiiA (+RBS) | LVA | Forward | 832 | |||
| 1 | BBa_C0261 | luxI | AHL-making Enzyme, luxI (+RBS) | LVA | Forward | 661 | |||
| 1 | BBa_J37033 | RBS + LuxR | 799 | ||||||
| A | W | BBa_K091138 | RBS+lsrR | 972 | |||||
| A | W | BBa_K091158 | RBS+lsrK | 1611 | |||||
| 1 | BBa_K131015 | LuxPQ from Vibrio harveyi | 3825 | ||||||
| 1 | BBa_K131016 | LuxOU from Vibrio harveyi | 1945 | ||||||
| 1 | W | BBa_K081008 | luxI protein generator (TERM-) | 664 | |||||
| 1 | BBa_K081009 | lasI protein generator (TERM-) | 688 | ||||||
| 1 | BBa_K081020 | cI and lasR protein generator (TERM-) | 1606 | ||||||
| A | W | BBa_K082007 | B0030-C0070 | 688 | |||||
| A | W | BBa_K082008 | B0032-C0070 | 686 | |||||
| A | W | BBa_K082010 | B0034-C0070 | 685 | |||||
| A | W | BBa_K332033 | 37℃ induced RBS + tetR + double terminator | 864 | |||||
| W | BBa_K772001 | EpCAM Binding Dock: C-terminus | 1159 | ||||||
| W | BBa_K772002 | EpCAM Binding Dock: N terminus | 1138 | ||||||
Composite parts
These are composite parts related to cell-cell signalling.
| -?- | Name | Type | Description | Length | |
|---|---|---|---|---|---|
| 1 | W | BBa_F1610 | Signalling | 3OC6HSL Sender Device | 798 |
| 1 | W | BBa_F2620 | Signalling | 3OC6HSL -> PoPS Receiver | 1061 |
| 1 | W | BBa_F2621 | Signalling | 3OC6HSL Receiver Device | 1158 |
| 1 | W | BBa_F2622 | Signalling | 3OC6HSL Receiver Device | 1062 |
| A | BBa_I0424 | Signalling | I0404.I6101 | 2700 | |
| A | BBa_I0426 | Signalling | I0406.I6107 | 2798 | |
| A | BBa_I0428 | Signalling | I0408.I6106 | 2872 | |
| BBa_I0429 | Signalling | I0408.I6116 | 2858 | ||
| 1 | BBa_I0460 | Generator | aiiA Device (B0034.C0060.B0015) | 969 | |
| 1 | W | BBa_I0462 | Generator | luxR Protein Generator | 936 |
| BBa_I0464 | Signalling | LasR Protein Generator | 936 | ||
| 1 | BBa_I0466 | Signalling | RhlR Protein Generator | 942 | |
| BBa_I0468 | Signalling | Cin R Protein Generator | 942 | ||
| A | BBa_I13018 | Signalling | LuxR Cassette under Ptet (Other) | 998 | |
| BBa_I13035 | Signalling | 3OC6HSL Receiver Device with Inducible Control of LuxR and a YFP Output device | 3003 | ||
| A | BBa_I13202 | Signalling | 3OC6HSL Sender Controlled by Lac Repressible Promoter | 803 | |
| U | BBa_I13203 | Signalling | pBad.aiiA protein generator (LVA-) | 2129 | |
| U | BBa_I13205 | Signalling | HSL/aiiA test construct | 4239 | |
| BBa_I13206 | Signalling | aiiA (LVA-) protein generator driven by ptet | 973 | ||
| A | BBa_I13207 | Signalling | HSL/aiiA test construct | 4142 | |
| A | BBa_I13208 | Signalling | aiiA (LVA-) protein generator driven by plac | 973 | |
| BBa_I13210 | Signalling | Lux/Cin Relaxation Oscillator | 5661 | ||
| BBa_I13211 | Signalling | Biobricked version of the natural Lux quorum sensing system | 1964 | ||
| BBa_I13212 | Signalling | LuxR Protein Generator Controlled by the Left Lux Promoter | 1095 | ||
| BBa_I13213 | Signalling | BioBricked version of the natural Lux system with order reversed | 1964 | ||
| A | W | BBa_I13261 | Signalling | Lux Receiver (I13263 with reversed part order) | 2044 |
| M | W | BBa_I13262 | Signalling | PoPS->PoPS Amplifier Controlled by 3OC6HSL | 999 |
| A | W | BBa_I13263 | Signalling | Lux Receiver (HSL & R0063 driven) | 2044 |
| BBa_I13264 | Signalling | Lux based Sender/Receiver/Reporter system | 2713 | ||
| BBa_I13265 | Signalling | Lux based Sender/Receiver/Reporter system (LVA-) | 2655 | ||
| BBa_I13266 | Signalling | Lux-based Sender/Receiver Device which outputs PoPS | 1827 | ||
| A | W | BBa_I13272 | Signalling | YFP Producer Controlled by 3OC6HSL Receiver Device | 2083 |
| A | W | BBa_I13273 | Signalling | YFP Producer Controlled by 3OC6HSL Receiver Device | 1947 |
| BBa_I13274 | Signalling | Lux Receiver (HSL & R0011 driven) | 1947 | ||
| BBa_I13277 | Signalling | PoPS->PoPS amplifier (CinR-based, HSL driven) | 1175 | ||
| 1 | BBa_I1466 | Signalling | RhlR protein generator (LVA-) | 884 | |
| BBa_I1467 | Signalling | AI-1 protein generator (LVA-) | 878 | ||
| A | BBa_I1468 | Generator | CinR protein generator | 884 | |
| BBa_I534060 | Signalling | aiiA Protein Generator (LVA+) Controlled by a tet Repressible Promoter | 2187 | ||
| A | W | BBa_I722006 | Signalling | GFP Producer Controlled by 3OC6HSL (without Promoter) | 1885 |
| A | BBa_I722011 | Composite | rhl producer followed by a AHL acceptor | 2702 | |
| A | BBa_I722012 | Composite | AHL->RoPs and mRFP producer | 2722 | |
| A | BBa_I724000 | Device | Autoinducer inactivation enzyme regulated by LuxR/HSL promoter | 895 | |
| A | W | BBa_I726031 | Device | Trc-LIC | 1552 |
| 1 | W | BBa_I726041 | Device | Sen-TIC | 1551 |
| A | W | BBa_I726061 | Device | Trc-LRY | 1748 |
| 1 | W | BBa_I726071 | Device | Rec-RRY | 1748 |
| 1 | W | BBa_I726081 | Device | Rec-LRY.RC | 2697 |
| A | BBa_I729004 | Composite | Sensitive AHL Receiver | 1920 | |
| A | W | BBa_I729005 | Composite | AHL Reporter and Quencher | 2650 |
| 1 | BBa_I729006 | Composite | AHL reporter and aiia device | 2985 | |
| A | BBa_I732923 | Device | I732907 I732922 | 5682 | |
| 1 | W | BBa_I751250 | Generator | pSB4 plac-luxI | 803 |
| A | W | BBa_I751350 | Generator | pBR322 plac-luxI | 803 |
| A | BBa_I761011 | Regulatory | CinR, CinL and glucose controlled promotor | 295 | |
| BBa_J06001 | Signalling | Tet repressible luxI generator ( LVA+ ) | 860 | ||
| BBa_J06002 | Signalling | Tet repressible luxI generator ( LVA- ) | 802 | ||
| BBa_J06101 | Signalling | Tet repressible lasI generator ( LVA+ ) | 884 | ||
| BBa_J06102 | Signalling | Tet repressible lasI generator ( LVA- ) | 826 | ||
| BBa_J06201 | Signalling | Tet repressible rhI generator (LVA+) | 884 | ||
| BBa_J06400 | Signalling | 3OC12HSL Receiver | 1147 | ||
| BBa_J06401 | Signalling | 30C12HSL Sender | 764 | ||
| BBa_J06402 | Signalling | C4HSL Receiver | 1044 | ||
| A | BBa_J07043 | Signalling | J07012.B0015 (scFv 4-4-20.TT) | 899 | |
| A | BBa_J07044 | Signalling | J07013.B0015 (scFv S101A.TT) | 899 | |
| A | BBa_J07045 | Signalling | J07014.B0015 (scFv 4M5.3.TT) | 899 | |
| A | BBa_J13040 | Signalling | pOmpR dependent 3OC6HSL sender device | 914 | |
| BBa_J85120 | Composite | High Population->mRFP (pLac->LuxI; pLacIQ->luxR; pLux->mRFP;) | 2653 | ||
| 1 | W | BBa_K081011 | Generator | luxR protein generator under Plambda regulation (TERM-) | 859 |
| 1 | W | BBa_K081015 | Generator | luxI protein generator - PoPS->luxI | 711 |
| 1 | W | BBa_K081019 | Generator | luxR protein generator under Plambda regulation | 906 |
| A | W | BBa_K082020 | Generator | LuxR generator | 998 |
| A | W | BBa_K082021 | Generator | RhlI generator | 1004 |
| A | W | BBa_K082023 | Generator | B0034-C0070-B0015 | 822 |
| A | W | BBa_K082029 | Generator | LuxI generator | 860 |
| A | W | BBa_K082030 | Generator | luxI generator on PSB3C5 | 860 |
| A | W | BBa_K082031 | Composite | R0071-B0030-C0070 | 749 |
| A | W | BBa_K082032 | Composite | R0071-B0032-C0070 | 747 |
| 1 | W | BBa_K082035 | Generator | RhlI generator | 884 |
| A | W | BBa_K082036 | Generator | LuxR & RhlI generator | 1890 |
| A | W | BBa_K082037 | Generator | RhlI & GFP generator | 1633 |
| A | BBa_K091134 | Device | Las Receiver with GFP reporter | 2048 | |
| A | W | BBa_K091139 | Generator | RBS+lsrR+TT | 1109 |
| 1 | ? | BBa_K091182 | Device | pLasR/cI-RBS-LuxI-RBS-Mnt-TT-pMnt/tetR-RBS-LuxI-RBS-cI-TT | 2988 |
| 1 | BBa_K091190 | Device | plux/cI+RBS+lasI+RBS+Mnt+TT+pMnt/lac+RBS+lasI+RBS+cI+TT | 2802 | |
| 1 | BBa_K091203 | Device | pBAD-RBS-LuxR-RBS-LacI(I12)-TT | 2183 | |
| A | W | BBa_K094103 | Device | plux-rbs-cheZ-terminator | 878 |
| A | W | BBa_K094106 | Device | Plux-rbs-CI-terminator-plambda P(O-R12)-rbs-cheZ | 2521 |
| A | W | BBa_K094112 | Device | luxR-luxI-terminator | 1552 |
| A | BBa_K116626 | Generator | BBa_B0032 + LuxR + BBa_B0015 | 937 | |
| A | W | BBa_K266000 | Signalling | PAI+LasR -> LuxI (AI) | 963 |
| A | BBa_K266002 | Coding | LasR + Term | 918 | |
| A | W | BBa_K266005 | Signalling | PAI+LasR -> LasI & AI+LuxR --| LasI | 819 |
| A | W | BBa_K266006 | Signalling | PAI+LasR -> LasI+GFP & AI+LuxR --| LasI+GFP | 1705 |
| A | W | BBa_K266007 | Signalling | Complex QS -> LuxI & LasI circuit | 2676 |
| A | W | BBa_K332031 | Generator | Constitutive promoter + 37℃ induced RBS + tetR + double terminator | 907 |
| A | W | BBa_K332032 | Generator | Constitutive promoter+37℃ induced RBS+tetR+double terminator+Ptet+RBS+GFP+double terminator | 1836 |
| W | BBa_K546000 | Signalling | Lux pL controlled LuxR with lux pR autoinducing LuxI(lva tag)- AHL. | 1964 | |
| W | BBa_K546001 | Composite | Lux pL controlled luxR with lux pR controlled AHL degrading enzyme AiiA(lva tag). | 2135 | |
| W | BBa_K546002 | Measurement | Lux pL controlled luxR with lux pR controlled GFP(lva tag). | 2080 | |
| W | BBa_K546003 | Signalling | Lux pL controlled LuxR + lux pR promoter. | 1158 | |
| W | BBa_K546005 | Composite | Lux pL controlled LuxR + lux pR autoinducing LuxI (lva tag) + lux pR controlled GFP(lva tag). | 4052 | |
| BBa_K574001 | Signalling | TetR regulated by 3OC6HSL | 1890 | ||
| BBa_K574004 | Signalling | 3OC12HSL regulated by TetR | 797 | ||
| BBa_K574005 | Signalling | 3OC12HSL and YFP regulated by pBad | 1712 | ||
| BBa_K574006 | Device | 3OC12HSL regulated by pTet and pBad | 2517 | ||
| W | BBa_K574009 | Signalling | 3OC12HSL -> PoPS Receiver | 1147 | |
| W | BBa_K772100 | Project | EpCAM Detection Device | 2305 | |
| BBa_S04301 | Coding | C0079:B0015 | 918 | ||
| BBa_T9001 | Signalling | GFP and Producer Controlled by 3OC6HSL Receiver Device | 1946 | ||
| 1 | W | BBa_T9002 | Signalling | GFP Producer Controlled by 3OC6HSL Receiver Device | 1945 |
| Barry Canton, as a graduate student in Drew Endy's lab, built and characterized the cell-cell signalling receiver BBa_F2620. |
